WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00012321 Gene Name  srxa-6
Sequence Name  ? W07A8.5 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Expressed in ASIL; ASIR; PHBL; and PHBR. Biotype  SO:0001217
Genetic Position  V :25.0409 ±0.001393 Length (nt)  ? 1223
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00012321

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:W07A8.5.1 W07A8.5.1 1043   V: 20734958-20736180
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:W07A8.5 W07A8.5 987   V: 20734983-20735217

15 RNAi Result

WormBase ID
WBRNAi00002322
WBRNAi00054935
WBRNAi00054936
WBRNAi00106340
WBRNAi00004979
WBRNAi00090901
WBRNAi00076744
WBRNAi00026508
WBRNAi00084317
WBRNAi00084320
WBRNAi00084321
WBRNAi00084322
WBRNAi00064133
WBRNAi00064134
WBRNAi00098508

23 Allele

Public Name
gk963271
gk964176
gk962705
gk963489
gk963304
gk963809
WBVar01756673
WBVar00073843
WBVar01467099
WBVar02005211
gk267801
gk267800
gk267799
WBVar01914144
WBVar01834950
gk795612
gk813661
gk485336
gk560226
gk604516
gk878867
gk508236
gk396576

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00012321 20734958 20736180 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

25 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-2(e1370)_upregulated_neuron
  Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-16(mu86)_upregulated_neuron
Temprature shift to 28C for 48 hours. Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 48 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_48h_upregulated
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the 3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-EtBr-exposed_51h
  Genes that showed significant differential expressed between control and 150 mg\/L Atrazine treatment. t-test, p < 0.05. WBPaper00036123:Atrazine_regulated
  Genes with differential expression under 1.0mg/l Diazinon treatment at 16 centigrade. To identify the differentially expressed genes in each treatment authors used linear models per toxicant and temperature (gene expression = Toxicant (effect) + error). The lm function in R stats package was used to implement the linear models analysis with recommended default options. For threshold determination authors used a permutation approach. For each of the 23,232 permutations used authors randomly picked a transcript (array spot), which could only be picked once. Authors combined all the expression values of this transcript and randomly distributed them over the replicates and used them in the linear model. In this way authors obtained a threshold for each of the toxicants. Authors used a -log10 p-value 2 as common threshold for the analysis, which resembles to the following FDR per toxicant: 0.0155 for CPF at 24 centigrade, 0.0148 for DZN at 24 centigrade, 0.0168 for CPF+DZN at 24 centigrade, 0.0142 for CPF at 16 centigrade, 0.0151 for DZN at 16 centigrade, and 0.0148 for CPF+DZN, at 16 centigrade. WBPaper00037113:Diazinon_16C_regulated
Fungi infection: Harposporium sp. Genes with decreased expression after 24 hours of infection by Harposporium Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:Harposporium_24hr_downregulated_RNAseq
  Transcripts that interact with 3xFLAG-DLC-1 as identified by immunoprecipitation followed by RNA sequencing. DESeq2, fold change > 2,, p-value < 0.01 WBPaper00055334:DLC-1_interacting
Fungi infection: Drechmeria coniospora Genes with increased expression after 12 hours of infection by D.coniospora Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:D.coniospora_12hr_upregulated_RNAseq
  Genes that showed significantly decreased expression after exposure to adsorbable organic bromine compounds (AOBr) contained in M. aeruginosa batch culture. Differentially expressed genes (DEGs) were identified with a random variance t-test and a significance analysis of microarrays (SAM) test. Genes were considered statistically significant if their p-value was less than 0.05, the false discovery rate less than 0.3, and the fold change compared to control at least <= 0.67 or >=1.5. WBPaper00046853:AOBr_M.aeruginosa-batch-culture_downregulated
  Transcripts that showed significantly increased expression in tetraploid N2 animals after exposure to 5 uM doxorubicin for 72 hours at 15C from L1 to L4 larve stage. DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. WBPaper00066110:Doxorubicin_upregulated_tetraploid
Bacteria Diet: L. plantarum with pdxH mutant vs. L. plantarum Transcripts that showed significantly increased expression in N2 animals fed with L. plantarum with pdxH mutant, comparing to in N2 animals fed with L. plantarum. GFold3, logFC < -1 or > 1. WBPaper00066703:L.plantarum-pdxH_upregulated
  Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-42-srw-113
  Transcripts that showed significantly decreased expression in spn-4(tm291) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:spn-4(tm291)_downregulated
Fungi infection: Drechmeria coniospora. 24 hours of infection. Genes that showed decreased expression after24 hours of infection by fungi Drechmeria coniospora. Differentially regulated genes based on fold change, corresponding to the uppermost 18.75th percentile of datasets formed using genes with normalized, expression ratios (infected/control) >1.01 or <0.99 in at least ten out of fourteen arrays are shown. WBPaper00032031:DConiospora_downregulated_OligoArray_24h
  Genes predicted to be upregulated more than 2.0 fold in rde-3(r459) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rde-3(r459)_upregulated
  Transcripts that showed significantly decreased expression in hlh-26(ok1453) animals exposed to E. faecium for 8 hours, comparing to N2 animals exposed to E. faecium for 8 hours. Fold change > 2. WBPaper00062585:hlh-26(ok1453)_downregulated_E.faecium
Drug treatment: Rhine sediment Genes with significantly changing transcripts in C. elegans exposed to the Rhine (R) sediment. [ANOVA, p < 0.05 without multiple sample correction, fold-change to reference sediment Danube (D) > 1.4 (up-regulated) or < 0.7 (down-regulated)]. WBPaper00033070:Rhine_upregulated
  Transcripts enriched in PHB according to single cell RNAseq. Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched. WBPaper00061651:PHB_enriched
  Single-cell RNA-Seq cell group 47_1 expressed in neuron. scVI 0.6.0 WBPaper00065841:47_1

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : ASH + ASI amphid neurons; PHB phasmid neuron. Very strong and consistent expression in PHB. Weaker and more inconsistently in ASH and very weak in ASI. (Sengupta Lab 2005) Strain: BC14847 [srxa-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCAATTTTTGGATTTTTCG] 3' and primer B 5' [TGAGAAAATCGACCTGGAGAA] 3'. Expr6850 Adult Expression: Nervous System; head neurons; tail neurons; Larval Expression: intestine; Nervous System; head neurons; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC16005 [srxa-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATCGGTTGATCGCCTTTTC] 3' and primer B 5' [TGAGAAAATCGACCTGGAGAA] 3'. Expr6851 Adult Expression: Nervous System; tail neurons; phasmids; Larval Expression: Nervous System; tail neurons; phasmids;  
    Expr14190 ASI (dim), sometimes ASH (vey dim and less consistent), PHB  
    Expr1158473 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2016874 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1023063 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00012321 20734958 20736180 1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1223

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00062324
WBStrain00003694

0 Upstream Intergenic Region