WormMine: Gene WBGene00015062

• WormBase Gene ID: WBGene00015062
• Gene Name: trx-1
• Sequence Name: B0228.5
• Brief Description: trx-1 encodes a thioredoxin, a small redox protein that functions as a protein-disulfide reductase; loss of trx-1 activity via a deletion mutation and RNAi indicates that trx-1 is required for normal adult lifespan; in vitro, TRX-1 is capable of reducing protein disulfide bonds in the presence of a mammalian thioredoxin reductase; a TRX-1::GFP fusion protein is expressed in the ASJL/R amphid chemosensory neurons in males and hermaphrodites beginning just prior to hatching and continuing through larval and adult stages, including the alternative dauer larval stage; expression is also variably detected in posterior intestinal cells in larvae and adults, but not in dauers; subcellularly, the TRX-1::GFP fusion protein is detected in the nucleus, cytoplasm, cilia, dendrites, and axons.
• Organism: Caenorhabditis elegans
• Automated Description: Enables protein-disulfide reductase activity. Involved in determination of adult lifespan. Located in several cellular components, including neuronal cell body; nucleus; and plasma membrane bounded cell projection. Expressed in ASJL; ASJR; head neurons; and in male.
• Biotype: SO:0001217
• Genetic Position: II :0.560059 ±0.000537
• Length (nt): 964

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00015062

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:B0228.5a.1	B0228.5a.1	552	II: 7752637-7753513
Transcript:B0228.5b.1	B0228.5b.1	586	II: 7752637-7753600

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:B0228.5a	B0228.5a	348	II: 7752817-7752885
CDS:B0228.5b	B0228.5b	345	II: 7752817-7752885

7 RNAi Result

• WBRNAi00038765
• WBRNAi00009608
• WBRNAi00028012
• WBRNAi00065059
• WBRNAi00065060
• WBRNAi00065061
• WBRNAi00108374

17 Allele

• gk963801
• gk963053
• gk962682
• gk604034
• gk741410
• gk624183
• gk448307
• gk550918
• gk358188
• jh127
• WBVar00104576
• gk147536
• gk147538
• gk147537
• WBVar02018069
• ok1449
• WBVar01960107

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00015062
• Start: 7752637
• End: 7753600
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

72 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Genes that were downregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Top 300 transcripts enriched in ABalppppppa, ABpraaapppa according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:ASE_parent
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
heat-shock hlh-1	Genes enriched in HLH-1 heat shock dataset.	A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets.	WBPaper00031003:hlh_1_enriched
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_upregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-2(e1370)_upregulated_neuron
	Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-16(mu86)_upregulated_neuron
	Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
	Total muscle depleted genes (complete list of non-overlapping genes from the 0hr and 24hr muscle depleted datasets).	A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets.	WBPaper00031003:total_muscle_depleted
organophosphorus pesticide exposure	Genes specifically affected by organophosphorus pesticide exposure. Dic	2-way ANOVA	WBPaper00033099:organophosphorus_pesticide_regulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin_downregulated
Skin Wounding: skin wounding using femtosecond or Micropoint UV laser or with single stabs of a microinjection needle to the anterior or posterior body 24 h after the L4 stage.	Transcripts that showed significantly increased expression after skin wounding using femtosecond or Micropoint UV laser or with single stabs of a microinjection needle to the anterior or posterior body 24 h after the L4 stage of N2 animals.	The cutoff for differential expressed genes (DEGs) were: Benjamini-Hochberg adjusted p-value less than 0.05 and fold change larger than 1.5.	WBPaper00059895:wounding_upregulated
	Genes with differential expression under 0.5mg/l Chlorpyrifos (CPF) treatment at 16 centigrade.	To identify the differentially expressed genes in each treatment authors used linear models per toxicant and temperature (gene expression = Toxicant (effect) + error). The lm function in R stats package was used to implement the linear models analysis with recommended default options. For threshold determination authors used a permutation approach. For each of the 23,232 permutations used authors randomly picked a transcript (array spot), which could only be picked once. Authors combined all the expression values of this transcript and randomly distributed them over the replicates and used them in the linear model. In this way authors obtained a threshold for each of the toxicants. Authors used a -log10 p-value 2 as common threshold for the analysis, which resembles to the following FDR per toxicant: 0.0155 for CPF at 24 centigrade, 0.0148 for DZN at 24 centigrade, 0.0168 for CPF+DZN at 24 centigrade, 0.0142 for CPF at 16 centigrade, 0.0151 for DZN at 16 centigrade, and 0.0148 for CPF+DZN, at 16 centigrade.	WBPaper00040210:Chlorpyrifos_16C_regulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:BAG-neuron_blastula-embryo_expressed
	Transcripts that showed altered expression in cat-2(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-2(RNAi)_regulated

14 Expression Patterns

• Primary Identifier: Expr2035657
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5025
• Remark: Also expressed in (comments from author) : difficult to detect of embryo is expressing Strain: BC13081
• Reporter Gene: [B0228.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGACCATGATTTTGAGTCG] 3' and primer B 5' [TACCATATCAGCAAGCTCCAGA] 3'.
• Pattern: Adult Expression: intestine - anterior cells; Larval Expression: intestine - anterior cells

• Primary Identifier: Expr5026
• Remark: Also expressed in (comments from author) : Might be neurons in the head. Strain: BC12018
• Reporter Gene: [B0228.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGACCATGATTTTGAGTCG] 3' and primer B 5' [TACCATATCAGCAAGCTCCAGA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Expr16067
• Pattern: We have found that C. elegans males have 4-fold increased basal levels of TRX-1 expression in ASJ neurons as compared with their hermaphrodite siblings.

• Primary Identifier: Expr3803
• Pattern: Stable transgenic lines expressing the trx-1::gfp translational fusion always resulted in GFP expression in a single pair of amphid neurons. A detailed anatomical analysis identified the ciliated chemosensory neuron pair ASJ-left and -right (ASJL, ASJR) as the cells expressing GFP. GFP fluorescence co-localizing with the fluorescent dye DiI in only one neuron pair, the ventral-most of the fluorescent dye-filling neurons, further confirmed ASJ as the neuron type expressing trx-1 in C. elegans. A detailed sex- and stage-specific analysis of GFP expression showed that GFP fluorescence is first detectable in both male and hermaphrodite in late 3-fold stage embryos, immediately prior to hatching. trx-1::gfp remains expressed in ASJ neurons through all stages, including dauer, until the animal dies. To some extent (in most transgenic animals at all larval stages and in adults, but not in dauers) GFP fluorescence was also detected in the intestine, readily distinguishable from gut autofluorescence, typically in the posterior-most intestinal cells. However, since the number of intestinal cells expressing GFP varied greatly between individuals, the intestinal GFP expression pattern could be due to genetic mosaicism, given that the transgenic animals analyzed in this study carry only extrachromosomal arrays and not integrated transgenes.
• Subcellular Localization: Fluorescence was readily detected in cilia, dendrites, cell bodies (cytoplasm and nucleus) and axons of the ASJ neurons.

• Primary Identifier: Expr12270
• Pattern: Transgenic embryos carrying a 3x28 bp tandem repeat in an otherwise promoter-less GFP reporter, showed expression in a pair of head neurons with dendrites extending to the tip of the head, consistent with ASJ morphology and position. However, once the embryo hatched, the number of animals with GFP-fluorescent ASJ neurons decreased dramatically. Very few L1 larvae showed expression in ASJ, but none in L2-L4 larvae or adult animals. This is most likely due to the requirement of additional cis-regulatory regions in the surrounding promoter area necessary for post-embryonic maintenance of trx-1 expression. A bipartite motif, within the trx-1 promoter, composed of two 6 bp elements (CAACCC and AATTAA), separated by a 3 bp linker, is absolutely required for ASJ expression. Hence, mutation of either of the two individual 6 bp elements resulted in the abolishment of GFP expression in ASJ neurons, while mutation of the 3 bp linker did not disrupt GFP expression.

• Primary Identifier: Expr12271
• Pattern: A minimal region of 116 bp (positioned at - 200 to -84 bp upstream of the trx-1b isoform ATG codon) drives GFP expression in ASJ, thus containing the putative cis-regulatory motif responsible for ASJ expression.

• Primary Identifier: Expr3993
• Remark: Gene_regulation: Interestingly, this pattern is altered in certain stress conditions: following starvation, expression is enhanced and spreads toward the anterior intestine. A similar modification of the gfp signal was seen in aged animals. Reporter gene fusion type not specified.
• Pattern: trx-1 expression was restricted to two pairs of head neurons and to posterior intestine and could be detected from the larval stages throughout the life span of the animals. The expression in hermaphrodites and males was identical.

• Primary Identifier: Expr13276
• Pattern: The expression of trx-1 was evident in the intestine.

• Primary Identifier: Expr1036436
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram1312
• Remark: Original chronogram file: chronogram.245.xml
• Reporter Gene: [B0228.5:gfp] transcriptional fusion.

• Primary Identifier: Expr2017518
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1014990
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1142974
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

9 GO Annotation

17 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00015062
• Start: 7752637
• End: 7753600
• Strand: -1

9 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 964

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00023529
• WBStrain00032031
• WBStrain00040309
• WBStrain00001990

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_7753601..7753986
• Length (nt): 386
• Chromosome Location: II: 7753601-7753986
• Organism: Caenorhabditis elegans