WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00013189 Gene Name  Y54E2A.4
Sequence Name  ? Y54E2A.4 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable several functions, including ATP binding activity; ATP hydrolysis activity; and helicase activity. Predicted to be located in endoplasmic reticulum and membrane. Human ortholog(s) of this gene implicated in autosomal recessive intellectual developmental disorder. Is an ortholog of human ASCC3 (activating signal cointegrator 1 complex subunit 3). Biotype  SO:0001217
Genetic Position  Length (nt)  ? 23528
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00013189

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:Y54E2A.4a.1 Y54E2A.4a.1 6513   II: 14754622-14778149
Transcript:Y54E2A.4b.1 Y54E2A.4b.1 3900   II: 14768462-14777737
Transcript:Y54E2A.4c.1 Y54E2A.4c.1 1431   II: 14773775-14777737
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:Y54E2A.4b Y54E2A.4b 3900   II: 14768462-14768742
CDS:Y54E2A.4c Y54E2A.4c 1431   II: 14773775-14774577
CDS:Y54E2A.4a Y54E2A.4a 6054   II: 14754669-14754705

12 RNAi Result

WormBase ID
WBRNAi00057373
WBRNAi00057375
WBRNAi00057376
WBRNAi00020978
WBRNAi00020979
WBRNAi00020980
WBRNAi00037471
WBRNAi00075528
WBRNAi00103613
WBRNAi00103615
WBRNAi00103614
WBRNAi00117960

480 Allele

Public Name
gk963801
gk963053
WBVar01320941
WBVar01320942
WBVar01320943
WBVar01320945
WBVar01320946
WBVar01320948
WBVar01320959
WBVar01320963
WBVar01320967
WBVar01320968
WBVar01320970
WBVar01320927
WBVar01320930
WBVar01320931
otn9644
gk962684
gk963297
WBVar01692151
WBVar02068531
WBVar02068533
WBVar01696587
WBVar01696588
WBVar01696589
WBVar01267385
WBVar01267396
WBVar01267407
WBVar01267418
WBVar01267429

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00013189 14754622 14778149 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_14778150..14778344   195 II: 14778150-14778344 Caenorhabditis elegans

133 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
Transgeneration hypoxia treatment. Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage. For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR. WBPaper00064871:hypoxia_upregulated_F1
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva. Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage. DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3. WBPaper00058958:100mGy-irradiation-72h_upregulated
  Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:sek-1(km4)_downregulated_cisplatin
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Genes down-regulated following nhr-25(RNAi). Pair-wise significance testing (mutant/RNAi vs. wild-type/vector) was performed using the Bioconductor package limma and p-values were initially corrected for multiple testing using the false discovery rate (FDR) method of Benjamini and Hochberg. Authors defined differential expression as log2(ratio) >= 0.848 with the FDR set to 5%, and p-value <= 0.001. WBPaper00045015:nhr-25(RNAi)_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:excretory-cell_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
Starvation Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl) DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:starvation_regulated_LowSalt
  Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C. EdgeR, FDR < 0.05, fold change < 0.5. WBPaper00055971:nhl-2(ok818)_25C_upregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L1-larva_expressed
  Genes with significantly increased expression in eat-2(ad465) treated with 2% DMSO for 72 hours, comparing to in N2 treated with 2% DMSO for 72 hours. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:eat-2(ad465)_upregulated_in-DMSO

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC13253 [Y54E2A.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTCGGACATTTTTCCACA] 3' and primer B 5' [ATCGATTTCCAGTTGTCGTTG] 3'. Expr7041 Adult Expression: Reproductive System; vulva other;  
    Expr2026139 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1160810 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1035860 Tiling arrays expression graphs  
    Expr2007897 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1012229 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

9 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables

1 Homologues

Type
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00013189 14754622 14778149 1

9 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
23528

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00002523

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_14753878..14754621   744 II: 14753878-14754621 Caenorhabditis elegans