WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00013281 Gene Name  sre-27
Sequence Name  ? Y57A10C.3 Organism  Caenorhabditis elegans
Automated Description  Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Expressed in neurons. Biotype  SO:0001217
Genetic Position  II :9.80767 ±0.008384 Length (nt)  ? 2088
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00013281

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:Y57A10C.3.1 Y57A10C.3.1 1236   II: 12415527-12417614
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:Y57A10C.3 Y57A10C.3 1095   II: 12415581-12415794

2 RNAi Result

WormBase ID
WBRNAi00057652
WBRNAi00021114

61 Allele

Public Name
gk963801
gk963053
gk962684
gk964116
cxTi8977
WBVar02067137
otn2817
WBVar01440636
WBVar01666705
WBVar01836264
WBVar01892227
gk942443
WBVar01892228
WBVar01892229
WBVar01892230
gk942442
WBVar01892223
WBVar01892224
WBVar01892225
WBVar01892226
WBVar01892219
WBVar01314520
WBVar01892220
WBVar01892221
WBVar01892222
WBVar01892215
WBVar01892216
WBVar01892217
WBVar01892218
WBVar01892211

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00013281 12415527 12417614 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_12414906..12415526   621 II: 12414906-12415526 Caenorhabditis elegans

28 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
  Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:sre-33-ZK1025.1_8337
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
Bacteria infection: Serratia marcescens Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Transcripts that showed significantly increaseded expression in sma-3(wk30) comparing to in N2 at L2 larva stage. Differentiallyexpressed genes between the different genotypes were identified using limma-voom. Fold change > 2. WBPaper00062491:sma-3(wk30)_upregulated
  Genes identified as down-regulated at a 5% false discovery rate through RNAseq experiments with three tatn-1(qd182) and three N2 RNA samples. ANOVA with FDR <= 0.05. WBPaper00044656:tatn-1(qd182)_downregulated
  Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C. N.A. WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C
  Transcripts depleted in Q cell. DESeq2 (version 2.11.40.7) FDR < 0.05, fold change > 2. WBPaper00066652:Q-cell_depleted
  Top 300 transcripts enriched in ABplapppaa, ABprapppaa according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:PVQ_parent
  Transcripts that showed significantly decreased expression in mex-1(or286) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-1(or286)_downregulated
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_RNAseq
  Transcripts that showed significantly decreased expression in unc-70(cas983) comparing to in N2 at L1 larva stage. DESeq2, fold change >= 2, FDR <= 0.05 WBPaper00057041:unc-70(cas983)_downregulated
Bacteria Diet: L. plantarum with pdxH mutant vs. L. plantarum Transcripts that showed significantly increased expression in N2 animals fed with L. plantarum with pdxH mutant, comparing to in N2 animals fed with L. plantarum. GFold3, logFC < -1 or > 1. WBPaper00066703:L.plantarum-pdxH_upregulated
  Transcripts that showed significantly decreased expression in spc-1(cas971) comparing to in N2 at L1 larva stage. DESeq2, fold change >= 2, FDR <= 0.05 WBPaper00057041:spc-1(cas971)_downregulated
  Top 300 transcripts enriched in Caapa according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:DVC_parent
  Top 300 transcripts enriched in ABplpppaapa, ABprpppaapa according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:Neuroblast_PVC_LUA
  Genes predicted to be upregulated more than 2.0 fold in rde-3(ne298) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rde-3(ne298)_upregulated
  Single-cell RNA-Seq cell group 48_0 expressed in neuron. scVI 0.6.0 WBPaper00065841:48_0
  Single-cell RNA-Seq cell group 101_0 expressed in neuron. scVI 0.6.0 WBPaper00065841:101_0
  Genes predicted to be upregulated more than 2.0 fold in eri-1(mg366) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:eri-1(mg366)_upregulated
  Transcripts that showed significantly decreased expression after exposed to 10ug per ml SiO2 nanoparticles from L1 larva to 1-day post L4 adult hermaphrodite stage. edgeR, fold change > 2 (set by curator), FDR < 0.05. WBPaper00059426:SiO2-nanoparticles_downregulated

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034506 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr14041 ADL, ASH (variable), ASJ (variable), another head neuron pair, PHA, PHB  
Strain: BC14827 [sre-27::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTAGATAGCAAGGATTTGAGCC] 3' and primer B 5' [TGAGGAGAGAAATTTGCAGGA] 3'. Expr7072 Adult Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids;  
    Expr1161061 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1018544 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2016278 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

4 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00013281 12415527 12417614 -1

4 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
2088

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00062451
WBStrain00003237

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_12417615..12419132   1518 II: 12417615-12419132 Caenorhabditis elegans