WormMine: Gene WBGene00016260

• WormBase Gene ID: WBGene00016260
• Gene Name: rege-1
• Sequence Name: C30F12.1
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable RNA endonuclease activity and mRNA binding activity. Predicted to be located in cytoplasmic ribonucleoprotein granule and nucleus. Expressed in tail. Human ortholog(s) of this gene implicated in hepatitis B. Is an ortholog of human ZC3H12A (zinc finger CCCH-type containing 12A); ZC3H12B (zinc finger CCCH-type containing 12B); and ZC3H12C (zinc finger CCCH-type containing 12C).
• Biotype: SO:0001217
• Genetic Position: I :1.57335±
• Length (nt): 6726

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00016260

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C30F12.1.1	C30F12.1.1	2164	I: 6954414-6961139

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C30F12.1	C30F12.1	1905	I: 6954673-6954838

24 RNAi Result

• WBRNAi00041546
• WBRNAi00053003
• WBRNAi00026253
• WBRNAi00026254
• WBRNAi00003036
• WBRNAi00004202
• WBRNAi00024686
• WBRNAi00087729
• WBRNAi00029354
• WBRNAi00035415
• WBRNAi00110211
• WBRNAi00001174
• WBRNAi00117040
• WBRNAi00110212
• WBRNAi00110210
• WBRNAi00110213
• WBRNAi00024684
• WBRNAi00024685
• WBRNAi00023066
• WBRNAi00023150
• WBRNAi00023662
• WBRNAi00023950
• WBRNAi00110209
• WBRNAi00110208

73 Allele

• gk962858
• gk962706
• gk963902
• otn9329
• WBVar01432009
• WBVar01712942
• gk420171
• gk672344
• gk409927
• gk312763
• gk630081
• gk931925
• gk594175
• gk518710
• gk759853
• gk334467
• gk409207
• gk409206
• gk483310
• gk755255
• gk715675
• gk815228
• gk497446
• gk719558
• gk702324
• gk471617
• gk439109
• gk659023
• gk609443
• gk602606

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00016260
• Start: 6954414
• End: 6961139
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_6954253..6954413
• Length (nt): 161
• Chromosome Location: I: 6954253-6954413
• Organism: Caenorhabditis elegans

161 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage.	DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05	WBPaper00064632:daf-2(e1370)_upregulated_intestine
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101.	DESeq2, Fold Change > 2 or < 0.5.	WBPaper00059566:wdr-23(mac32)_upregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_downregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin.	N.A.	WBPaper00055862:antimycin_damt-1(gk961032)_regulated
	Genes that showed increased expression after germline ablation comparing to un-ablated animals.	The differential expression between germline-ablated versus gonad-ablated animals was computed via the functions makeContrasts and contrasts.fit in the limma package in R/Bioconductor.	WBPaper00045571:germline-ablation_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult

9 Expression Patterns

• Primary Identifier: Expr5383
• Remark: Strain: DM12665
• Reporter Gene: [C30F12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCACGTGTGCAATGTT] 3' and primer B 5' [ATCGATCTTGAAATTTTGTGGTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; uterine-seam cell; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: pharynx; intestine; Reproductive System; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5384
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11849
• Reporter Gene: [C30F12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCACGTGTGCAATGTT] 3' and primer B 5' [ATCGATCTTGAAATTTTGTGGTTT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; nerve ring; amphids; Larval Expression: intestine; Nervous System; nerve ring; amphids

• Primary Identifier: Expr5385
• Remark: Also expressed in (comments from author) : Possibly seeing arcade cells. Strain: BC12665
• Reporter Gene: [C30F12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCACGTGTGCAATGTT] 3' and primer B 5' [ATCGATCTTGAAATTTTGTGGTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; uterine-seam cell; vulva other; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; Reproductive System; developing vulva; uterine-seam cell; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr13167
• Pattern: REGE-1::GFP is mostly expressed in the intestinal cells adjacent to the pharynx.

• Primary Identifier: Expr1036955
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2015294
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1018877
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1145564
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2033528
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

9 GO Annotation

24 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00016260
• Start: 6954414
• End: 6961139
• Strand: -1

9 Ontology Annotations

4 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in rege-1(imm070) comparing to in N2 animals fed with OP50.	DESeq2 (v 2.11.40.7) adjusted p value < 0.05, fold change > 2.	WBPaper00065877:rege-1(imm070)_upregulated_OP50
	Transcripts that showed significantly increased expression in rege-1(imm070) comparing to in N2 animals fed with PA14.	DESeq2 (v 2.11.40.7) adjusted p value < 0.05, fold change > 2.	WBPaper00065877:rege-1(imm070)_upregulated_PA14
	Transcripts that showed significantly decreased expression in rege-1(imm070) comparing to in N2 animals fed with OP50.	DESeq2 (v 2.11.40.7) adjusted p value < 0.05, fold change > 2.	WBPaper00065877:rege-1(imm070)_downregulated_OP50
	Transcripts that showed significantly decreased expression in rege-1(imm070) comparing to in N2 animals fed with PA14.	DESeq2 (v 2.11.40.7) adjusted p value < 0.05, fold change > 2.	WBPaper00065877:rege-1(imm070)_downregulated_PA14

1 Sequence

• Length: 6726

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00001911
• WBStrain00006134

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_6961140..6967669
• Length (nt): 6530
• Chromosome Location: I: 6961140-6967669
• Organism: Caenorhabditis elegans