WormMine: Gene WBGene00017648

• WormBase Gene ID: WBGene00017648
• Gene Name: ddo-3
• Sequence Name: F20H11.5
• Brief Description: ddo-3 encodes a secreted D-aspartate oxidase (DASPO), paralogous to DDO-1 and DDO-2; recombinant DDO-3 protein exhibits DDO activity in a FAD-dependent manner; DDO-3 is secreted to the oocyte surface, uterine space, seminal fluid and coelomocytes in a signal peptide-dependent manner; ddo-3 is involved in D-glutamate and L-tryptophan metabolism, self-fertility, hatching, nose touch response and lifespan; ddo-3 is expressed in a head mesodermal cell, hypodermis, other head cells, and vulva.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable D-aspartate oxidase activity and FAD binding activity. Predicted to be involved in D-amino acid catabolic process. Located in extracellular region. Expressed in several structures, including coelomocyte; eggshell; excretory socket cell; non-striated muscle; and seminal vesicle.
• Biotype: SO:0001217
• Genetic Position: III :-1.06191 ±0.000479
• Length (nt): 1535

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00017648

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F20H11.5.1	F20H11.5.1	1310	III: 6587864-6589398

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F20H11.5	F20H11.5	1152	III: 6587897-6587939

6 RNAi Result

• WBRNAi00045144
• WBRNAi00045150
• WBRNAi00013647
• WBRNAi00013989
• WBRNAi00006550
• WBRNAi00031191

25 Allele

• gk964518
• gk964032
• gk964033
• tm11457
• WBVar01656897
• WBVar01656898
• tm2028
• WBVar01722638
• gk957737
• gk383951
• gk578942
• gk432367
• gk915122
• gk777501
• gk623289
• gk891657
• gk665590
• gk546045
• WBVar01995412
• WBVar00057230
• gk176866
• gk176868
• gk176867
• gk176870
• gk176869

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00017648
• Start: 6587864
• End: 6589398
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

228 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Single-cell RNA-Seq cell group 21_1 with unidentified tissue expression pattern.	scVI 0.6.0	WBPaper00065841:21_1
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage.	DEseq2, fold change > 2	WBPaper00064505:tamoxifen_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted

11 Expression Patterns

• Primary Identifier: Expr5814
• Remark: Also expressed in (comments from author) : hypodermis is in the head. Strain: BC14036
• Reporter Gene: [F20H11.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGCTTAGTGTCCTTTTACCTCC] 3' and primer B 5' [AGCATACCACCTGCGATTAAATA] 3'.
• Pattern: Adult Expression: Reproductive System; vulva other; gonad sheath cells; head mesodermal cell; hypodermis; unidentified cells in head; Larval Expression: head mesodermal cell; hypodermis; unidentified cells in head

• Primary Identifier: Expr13979
• Pattern: DDO-3::mCherry was localized in the excretory pore cell, head tip cells, and hypodermal cells. On the other hand, DDO-3::mCherry was not localized in proximal gonadal sheath cells at any point during development, suggesting that DDO-3 is secreted from these cells in a SP-dependent manner. Interestingly, in the adult stage, DDO-3::mCherry was localized on the surface of the oocyte, which is surrounded by gonadal sheath cells, suggesting that DDO-3 produced in and secreted from proximal gonadal sheath cells is transferred to the oocyte surface. Furthermore, DDO-3::mCherry was also localized in the eggshell within the adult uterus, as well as in the uterine space, and it remained localized in the eggshell until hatching. In hermaphrodites, in addition to the excretory pore cell, head tip cells, hypodermal cells, oocyte surface, uterine space, and eggshell, DDO-3::mCherry was also present in coelomocytes from the late embryonic stage, and accumulated in vesicle-like structures at least from the adult stage.

• Primary Identifier: Expr13980
• Pattern: In males, DDO-3::mCherry was localized in the excretory pore cell, head tip cells, hypodermal cells, seminal vesicle cells, tail cells, and spicule cells. By contrast, DDO-3::mCherry was also localized in the tail fan from the adult stage, suggesting that DDO-3 is secreted in a SP-dependent manner from the cells where it is produced and transferred to the tail fan. Interestingly, DDO-3::mCherry was localized in vesicle-like structures in the seminal vesicle, where spermatids are stored until ejaculation. Because the seminal vesicle is composed of 20 secretory cells, we presumed that DDO-3 was secreted from the seminal vesicle into the seminal fluid and transferred to the hermaphrodite during mating. To test this possibility, we examined the uteri of hermaphrodites just after mating with transgenic males carrying the ddo-3::mCherry reporter gene. DDO-3::mCherry was dispersed throughout the uterus, suggesting that DDO-3 is a seminal fluid protein. Taken together, these results are consistent with the idea that DDO-3 is secreted from the seminal vesicle into the seminal fluid in a SP-dependent manner, and then transferred to the hermaphrodite uterus through mating. This fusion protein was also present in coelomocytes of males. During larval stages L1 and L2, localization of DDO-3::mCherry outside coelomocytes was limited to the excretory pore cell, implying that DDO-3 expressed in excretory pore cells is secreted into the body fluid. Indeed, at least in the adult stage, DDO-3::mCherry in excretory pore cells was localized to vesicle-like structures.

• Primary Identifier: Expr13977
• Pattern: In hermaphrodites, expression of Pddo-3::mCherry was observed in the excretory pore cell from the late embryonic stage, in head tip cells from larval stage L3, in vulval cells from L4, and in hypodermal cells and proximal gonadal sheath cells from the adult stage.

• Primary Identifier: Expr13978
• Pattern: In males, Pddo-3::mCherry was expressed in the excretory pore cell, head tip cells, and hypodermal cells, in a pattern similar to that observed in hermaphrodites. Moreover, this reporter protein was expressed in seminal vesicle cells from L4 and in tail cells and spicule cells from the adult stage.

• Primary Identifier: Expr9988
• Pattern: GFP expression was not observed in the intestine of transgenic worms expressing the Pddo-3::GFP construct. In these worms, GFP expression appeared in probable head mesodermal cells and unidentified cells in the head during the L3 to adult stages, in vulval muscles during the L4 to adult stages, and in the hypodermis and gonad sheath cells only during the adult stage. In the gonad sheath cells, the GFP signal in the U-shaped region was much brighter than in the other regions. In male worms expressing the Pddo-3::GFP construct, GFP expression was observed in probable head mesodermal cells and unidentified cells in the head during stages L3 to adult, and in hypodermis, seminal vesicle and tail cells only during the adult stage. Thus, a sex-specific difference was observed in DDO-3 expression and localization patterns.

• Primary Identifier: Expr2010830
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1017101
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1149093
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1806
• Remark: Original chronogram file: chronogram.718.xml
• Reporter Gene: [F20H11.5:gfp] transcriptional fusion.

• Primary Identifier: Expr2029068
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

17 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00017648
• Start: 6587864
• End: 6589398
• Strand: 1

17 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1535

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00002837

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_6586581..6587863
• Length (nt): 1283
• Chromosome Location: III: 6586581-6587863
• Organism: Caenorhabditis elegans