WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulva other; gonad sheath cells; head mesodermal cell; hypodermis; unidentified cells in head; Larval Expression: head mesodermal cell; hypodermis; unidentified cells in head; Primary Identifier  Expr5814
Remark  Also expressed in (comments from author) : hypodermis is in the head. Strain: BC14036 Reporter Gene  [F20H11.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGCTTAGTGTCCTTTTACCTCC] 3' and primer B 5' [AGCATACCACCTGCGATTAAATA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

6 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
Epidermal layer. hypodermis epidermis WBbt:0005733
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis. gonadal sheath cell   WBbt:0005828
Head mesodermal cell, function unknown head mesodermal cell hmc WBbt:0004697
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00017648 ddo-3 F20H11.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023