WormMine: Gene WBGene00018076

• WormBase Gene ID: WBGene00018076
• Gene Name: pifk-1
• Sequence Name: F35H12.4
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable 1-phosphatidylinositol 4-kinase activity. Involved in regulation of basement membrane organization. Predicted to be located in cytoplasm and membrane. Expressed in head and tail. Human ortholog(s) of this gene implicated in autosomal dominant nonsyndromic deafness. Is an ortholog of human PI4KB (phosphatidylinositol 4-kinase beta).
• Biotype: SO:0001217
• Genetic Position: X :-18.9261±
• Length (nt): 4315

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00018076

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F35H12.4.1	F35H12.4.1	2113	X: 920197-924511

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F35H12.4	F35H12.4	2001	X: 920307-920491

12 RNAi Result

• WBRNAi00109088
• WBRNAi00109077
• WBRNAi00046426
• WBRNAi00014383
• WBRNAi00031816
• WBRNAi00108930
• WBRNAi00108985
• WBRNAi00108820
• WBRNAi00108875
• WBRNAi00109040
• WBRNAi00109074
• WBRNAi00109079

48 Allele

• gk963652
• gk963725
• WBVar00074603
• WBVar00074602
• WBVar01979129
• WBVar01824038
• WBVar01824039
• WBVar01824040
• gk638851
• gk349556
• gk920471
• gk739820
• gk913189
• gk688940
• gk819683
• gk409125
• gk792082
• gk734562
• gk691025
• gk789800
• gk373591
• gk709616
• gk637534
• gk660165
• gk637533
• gk519144
• gk543363
• gk540959
• gk544032
• h11569

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00018076
• Start: 920197
• End: 924511
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_920178..920196
• Length (nt): 19
• Chromosome Location: X: 920178-920196
• Organism: Caenorhabditis elegans

70 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-1(RNAi)_regulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in pgl-1(ct131) animals (isolated from SS0002[pgl-1(ct131)him-3(e1147)], comparing to in control animals SS1174, at 1-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_pgl-1(ct131)_vs_control_day1-adult
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector.	Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples.	WBPaper00051039:germline_enriched
Bacteria infection: Xenorhabdus nematophila	Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila.	Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets.	WBPaper00041606:CE_X.nematophila_regulated
	Transcripts that showed significantly decreased expression in oocyte germline cells comparing to in mitosis germline cells.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:oocyte_vs_mitosis_downregulated
	Transcripts with significantly increased expression after treatment with 0.1mM paraquat vs. control	Comparisons of each genotype were compared to the wild-type using the Empirical Base (Wright & Simon) algorithm and fold changes were represented on a log2 scale. A threshold of p < 0.05 and a fold change of 1.3 (log2) was set to determine differentially expressed targets.	WBPaper00045263:0.1mM-paraquat_upregulated
	Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C.	N.A.	WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C
	Genes that showed flat mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:flat_dev_expression
	Transcripts that showed significantly increased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_upregulated
	Transcripts that showed altered expression in cat-2(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-2(RNAi)_regulated
	Transcripts that showed significantly decreased expression in the germline of iff-1(RNAi) animals comparing to the germine of N2 animals applied with control vector at 15C.	Statistical comparisons were made by two-tailed t-test, n=3 (each replicate contains 150 extruded germ lines from N2 wild-type worms), P < 0.01 was considered significant.	WBPaper00057288:iff-1(RNAi)_downregulated_transcript
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_fem-3(q20)
Bacteria infection: Erwinia carotovora	Genes down-regulated in animals infected with Erwinia carotovora compared to the E. coli OP50 control after 24h of infection.	MAANOVA and BRB-Array-Tools.	WBPaper00030985:Erwinia_carotovora_downregulated
	Transcripts that interact with both BAZ-2 and SET-6 in Chip-Seq analysis.	N.A.	WBPaper00059356:BAZ-2_SET-6_interacting

7 Expression Patterns

• Primary Identifier: Expr5964
• Remark: Strain: BC14064
• Reporter Gene: [F35H12.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAAAACCAACAAATTCGTATGAC] 3' and primer B 5' [GGATTGTCCAACTCTGCCTATC] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulva other; seam cells; Nervous System; nerve ring; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; seam cells; Nervous System; nerve ring; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr1150294
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1021953
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1037789
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2014921
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1308
• Remark: Original chronogram file: chronogram.2428.xml
• Reporter Gene: [F35H12.4:gfp] transcriptional fusion.

• Primary Identifier: Expr2033156
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

12 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00018076
• Start: 920197
• End: 924511
• Strand: -1

12 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4315

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00002851

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_924512..924957
• Length (nt): 446
• Chromosome Location: X: 924512-924957
• Organism: Caenorhabditis elegans