WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00016827 Gene Name  sre-53
Sequence Name  ? C50E10.3 Organism  Caenorhabditis elegans
Automated Description  Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Expressed in head. Biotype  SO:0001217
Genetic Position  II :7.9401 ±0.027492 Length (nt)  ? 2213
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00016827

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C50E10.3.1 C50E10.3.1 1104   II: 12321193-12323405
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C50E10.3 C50E10.3 1104   II: 12321193-12321406

3 RNAi Result

WormBase ID
WBRNAi00042899
WBRNAi00042900
WBRNAi00012214

72 Allele

Public Name
gk963801
gk963053
gk962684
gk964116
WBVar02067088
WBVar01605458
WBVar01605459
WBVar01605455
WBVar01605456
WBVar01605457
otn14465
WBVar01936156
WBVar01936157
WBVar01936155
WBVar00106162
WBVar01400537
WBVar01666703
WBVar02103076
gk157004
gk157003
WBVar01539072
gk157005
WBVar00177301
WBVar00602103
gk942424
WBVar00177302
WBVar00177300
WBVar00177305
WBVar00177306
WBVar00230169

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00016827 12321193 12323405 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_12321071..12321192   122 II: 12321071-12321192 Caenorhabditis elegans

23 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:sre-33-ZK1025.1_8337
  Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. WBPaper00066110:tetraploid_vs_diploid_downregulated
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts that showed significantly increased expression in cfp-1(tm6369) comparing to in N2 at early embryo stage. DESeq2, FDR < 0.05 WBPaper00058691:cfp-1(tm6369)_upregulated
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed in control vsafter UVC exposure without EtBr treatment, at the 3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-exposed_51h
  Genes that showed decreased expression after 0.1uM DBAA treatment comparing with control. Differentially expressed genes (DEGs) were identified with a random variance t test and a significance analysis of microarrays (SAM) test. Genes were considered statistically significant if their p value was less than 0.05, the false discovery rate less than 0.3 and the fold change compared to control at least <= 0.67 or >= 1.5. WBPaper00045294:0.1uM_DBAA_downregulated
Bacteria infection: Serratia marcescens Genes with decreased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:S.marcescens_24hr_downregulated_TilingArray
  Transcripts enriched in invading anchor cells comparing to in whole animal. DESeq2v.1.30.1. fold change >= 2, FDR < 0.05 WBPaper00065258:anchor-cell_enriched
  Genes that showed significantly increased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control. Fold change > 1.2 or < 0.8. WBPaper00042477:rsr-2(RNAi)_upregulated_TilingArray
  Transcripts that showed significantly increased expression in set-2(bn129) comparing to in N2 at early embryo stage. DESeq2, FDR < 0.05 WBPaper00058691:set-2(bn129)_upregulated
  Genes that showed significantly increased expression after exposure to adsorbable organic bromine compounds (AOBr) contained in M. aeruginosa batch culture. Differentially expressed genes (DEGs) were identified with a random variance t-test and a significance analysis of microarrays (SAM) test. Genes were considered statistically significant if their p-value was less than 0.05, the false discovery rate less than 0.3, and the fold change compared to control at least <= 0.67 or >=1.5. WBPaper00046853:AOBr_M.aeruginosa-batch-culture_upregulated
  Transcripts that showed significantly increased expression in drh-3(rrr2) comparing to in N2. edgeR, log2 fold change > 2 or < -2. WBPaper00053888:drh-3(rrr2)_upregulated
  Genes that showed decreased expression after 50uM DBAA treatment comparing with control. Differentially expressed genes (DEGs) were identified with a random variance t test and a significance analysis of microarrays (SAM) test. Genes were considered statistically significant if their p value was less than 0.05, the false discovery rate less than 0.3 and the fold change compared to control at least <= 0.67 or >= 1.5. WBPaper00045294:50uM_DBAA_downregulated
  Genes predicted to be upregulated more than 2.0 fold in rrf-2(ok210) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rrf-2(ok210)_upregulated
  Transcripts that showed significantly increased expression in RB1035[flcn-1(ok975)] comparing to in N2 at young adult stage. Agilent microarray raw data were processed and quantile normalized with the marray package from the Bioconductor project. Fold change statistics and Students t-test were used to create lists of candidates for differential gene expression. WBPaper00042236:flcn-1(ok975)_upregulated
  Genes predicted to be upregulated more than 2.0 fold in rde-3(r459) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rde-3(r459)_upregulated
  Top 300 transcripts enriched in rect_D according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:rect_D
  Transcripts that showed significantly increased expression in lin-15B(we23) comparing to in N2 animals at starved L1 larva stage. A gene model was built based on the WS260 annotation. Tag counts for each gene were extracted from STAR aligned BAM files, anddifferential gene expression between N2 and mutant backgrounds was tested using DESeq2. A false discovery rate(FDR) < 0.01 and LFC > 0.5849 was used to define genes as upregulated, and FDR < 0.01 and LFC < -1 was used to define genes asdownregulated. WBPaper00062056:lin-15B(we23)_upregulated
  Transcripts that showed significantly increased expression in lin-37(n758) comparing to in N2 animals at starved L1 larva stage. A gene model was built based on the WS260 annotation. Tag counts for each gene were extracted from STAR aligned BAM files, anddifferential gene expression between N2 and mutant backgrounds was tested using DESeq2. A false discovery rate(FDR) < 0.01 and LFC > 0.5849 was used to define genes as upregulated, and FDR < 0.01 and LFC < -1 was used to define genes asdownregulated. WBPaper00062056:lin-37(n758)_upregulated

5 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034532 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : Unidentified cells in head, possibly neural. Strain: BC12211 [C50E10.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTTCAAATTCCCGAAGAACT] 3' and primer B 5' [GCAGAAATATGATTACCGAGTTGA] 3'. Expr5553 Adult Expression: intestine; unidentified cells in head; Larval Expression: intestine; hypodermis; unidentified cells in head;  
    Expr2016306 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1146872 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1013076 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

4 GO Annotation

Annotation Extension Qualifier
  involved_in
  located_in
  located_in
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00016827 12321193 12323405 -1

4 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  located_in
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
2213

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00062368
WBStrain00002063

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_12323406..12324458   1053 II: 12323406-12324458 Caenorhabditis elegans