WormMine: Gene WBGene00018604

• WormBase Gene ID: WBGene00018604
• Gene Name: uggt-1
• Sequence Name: F48E3.3
• Brief Description: uggt-1 encodes one of two C. elegans homologs of UDP-Glc:glycoprotein glucosyltransferase (UGGT), an endoplasmic reticulum enzyme involved in quality control of glycoprotein folding; expression of uggt-1 in S. pombe cells lacking functional UGGT activity indicates that UGGT-1 displays UDP-Glc:glycoprotein glucosyltransferase activity; loss of uggt-1 activity via RNAi results in larval developmental delay and a shortened lifespan; uggt-1 is expressed throughout larval development, with peak levels seen at the L2/L3 stages, and uggt-1 expression is upregulated in an ire-1-dependent manner in response to endoplasmic reticulum stress; a uggt-1::gfp promoter fusion is expressed in the nervous system, including the amphid and phasmid neurons, the nerve ring, and the dorsal and ventral nerve cords.
• Organism: Caenorhabditis elegans
• Automated Description: Enables UDP-glucose:glycoprotein glucosyltransferase activity. Involved in IRE1-mediated unfolded protein response; protein N-linked glycosylation via asparagine; and regulation of nematode larval development. Predicted to be located in endoplasmic reticulum. Expressed in several structures, including anal depressor muscle; germ line; neurons; pharyngeal-intestinal valve; and rectal gland cell. Is an ortholog of human UGGT1 (UDP-glucose glycoprotein glucosyltransferase 1) and UGGT2 (UDP-glucose glycoprotein glucosyltransferase 2).
• Biotype: SO:0001217
• Genetic Position: X :-1.66215±
• Length (nt): 5289

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00018604

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F48E3.3.1	F48E3.3.1	4723	X: 7495694-7500982

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F48E3.3	F48E3.3	4482	X: 7495929-7496096

14 RNAi Result

• WBRNAi00001490
• WBRNAi00047742
• WBRNAi00015248
• WBRNAi00032484
• WBRNAi00093463
• WBRNAi00093465
• WBRNAi00093461
• WBRNAi00093468
• WBRNAi00093459
• WBRNAi00093470
• WBRNAi00093472
• WBRNAi00093961
• WBRNAi00093925
• WBRNAi00093890

89 Allele

• gk964260
• gk963873
• gk963874
• gk964088
• gk964087
• gk964005
• gk964003
• WBVar01820277
• WBVar01820278
• WBVar02027219
• WBVar01654838
• h17824
• gk673649
• gk924557
• gk832501
• gk832500
• gk344842
• gk498351
• gk502425
• gk371655
• gk615211
• gk645883
• gk672203
• gk398493
• gk576887
• gk755140
• gk366539
• gk529439
• gk443209
• gk638412

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00018604
• Start: 7495694
• End: 7500982
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_7495592..7495693
• Length (nt): 102
• Chromosome Location: X: 7495592-7495693
• Organism: Caenorhabditis elegans

174 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Expression Pattern Group C, enriched for genes involved in metabolic processes.	The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05.	WBPaper00036286:Pattern_C
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:sek-1(km4)_downregulated_cisplatin
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed

14 Expression Patterns

• Primary Identifier: Expr2035891
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6111
• Remark: Strain: BC13291
• Reporter Gene: [F48E3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTATTTACCGCTGGACGC] 3' and primer B 5' [CCTGTTAGGTTGATAATTACCTGG] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons

• Primary Identifier: Expr6112
• Remark: Strain: BC13719
• Reporter Gene: [F48E3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTATTTACCGCTGGACGC] 3' and primer B 5' [CCTGTTAGGTTGATAATTACCTGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr14990
• Pattern: UGGT-1 is expressed in the head, both in the pharynx, (corpus, isthmus and terminal bulb and buccal cavity) and in the pharyngeal intestinal valve. Expression is detected in the hypodermis and in the secretory gland. The somatic cells of the spermatheca express UGGT-1, but not the germline. Consistent with our previous findings (Buzzi et al., 2011) UGGT-1 is widely expressed in the nervous system, both in ventral and dorsal nerve cords, as well as in the muscle cells and in the anal depressor muscle. In the tail expression is also observed both in the anal rectal gland and the intestine.

• Primary Identifier: Expr11245

• Primary Identifier: Expr1151576
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr4054
• Remark: Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http://nematode.lab.nig.ac.jp).
• Pattern: Broadly expressed in soma/germline?.

• Primary Identifier: Expr9683
• Reporter Gene: [uggt-1::GFP] transcriptional fusion. uggt-1 (F48E3.3) promoter sequence was PCR amplified using pDONR P4-P1R vector, obtained from the C. elegans Promoter Library from Open Biosystems (Alabama USA), with a high fidelity polymerase (Hot start KOD, Roche) and cloned into the pPD95.75 polylinker (Addgene) immediately upstream of the GFP coding region to generate the Promoter uggt-1::gfp fusion construct.
• Pattern: GFP expression was detected in larvae and adults transgenic worms containing the uggt-1::gfp construct in cells of the nervous system, amphid neurons of the head and the nerve ring; neurons in the dorsal and ventral nerve cords and neurons along the body. Expression was also observed in the phasmid neurons located at the lateral side of the tail.

• Primary Identifier: Expr9682
• Pattern: Real-time PCR analysis revealed that uggt-1 and uggt-2 genes are indeed transcribed throughout the C. elegans life cycle with a maximum at the L2/L3 stage. Even though uggt-1 and uggt-2 share the same expression pattern during development, the level of uggt-2 transcription was much lower (at most 3%) than that of uggt-1 at all stages.

• Primary Identifier: Expr1038005
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2017752
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1016082
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1268
• Remark: Original chronogram file: chronogram.2390.xml
• Reporter Gene: [F48E3.3:gfp] transcriptional fusion.

• Primary Identifier: Chronogram2040
• Remark: Original chronogram file: chronogram.95.xml
• Reporter Gene: [F48E3.3:gfp] transcriptional fusion.

21 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00018604
• Start: 7495694
• End: 7500982
• Strand: -1

21 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5289

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00002539

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_7500983..7501414
• Length (nt): 432
• Chromosome Location: X: 7500983-7501414
• Organism: Caenorhabditis elegans