WormMine: Gene WBGene00020596

• WormBase Gene ID: WBGene00020596
• Gene Name: oga-1
• Sequence Name: T20B5.3
• Brief Description: oga-1 encodes an ortholog of mammalian O-linked N-acetylglucosamine(O-GlcNAc)-selective N-acetyl-beta-D-glucosaminidase (O-GlcNAcase); apolymorphism of OGA-1's human ortholog MGEA5 is associated with type 2diabetes, and OGA-1 appears to be required for fine-tuning of insulinsignalling; oga-1(ok1207) mutants are viable and fertile but accumulateO-GlcNAc on nuclear pores and other proteins, while showingS/T-phosphorylation of proteins, increased GSK-3beta activity, excessglycogen and trehalose, and decreased lipid storage; oga-1(ok1207)mutations enhance the Daf-c phenotype of daf-2(e1370ts) alleles even underconditions where oga-1(ok1207) alone diminishes dauer formation.
• Organism: Caenorhabditis elegans
• Automated Description: Enables hexosaminidase activity and protein serine/threonine phosphatase activity. Involved in several processes, including dauer larval development; glycogen metabolic process; and negative regulation of protein glycosylation. Expressed in body wall musculature; coelomocyte; nerve ring; pharyngeal muscle cell; and rectal muscle. Used to study type 2 diabetes mellitus. Is an ortholog of human OGA (O-GlcNAcase).
• Biotype: SO:0001217
• Genetic Position: X :1.06657 ±0.015356
• Length (nt): 4098

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00020596

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T20B5.3a.1	T20B5.3a.1	3026	X: 9343333-9347428
Transcript:T20B5.3b.1	T20B5.3b.1	3080	X: 9343335-9347430

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T20B5.3a	T20B5.3a	2565	X: 9343744-9343907
CDS:T20B5.3b	T20B5.3b	2619	X: 9343744-9343907

10 RNAi Result

• WBRNAi00110199
• WBRNAi00001344
• WBRNAi00002375
• WBRNAi00053604
• WBRNAi00018892
• WBRNAi00035695
• WBRNAi00110204
• WBRNAi00087508
• WBRNAi00108167
• WBRNAi00110201

70 Allele

• gk964260
• gk962707
• gk963732
• otn10439
• gk964126
• WBVar02065589
• gk951738
• h4394
• h5052
• WBVar00081898
• tm3642
• ttTi9533
• WBVar01945808
• WBVar00601532
• WBVar00603879
• gk3513
• ok1207
• gk386697
• gk598929
• gk805054
• gk723976
• gk798320
• gk584745
• gk726130
• gk902895
• gk422560
• gk564310
• gk418067
• gk509957
• gk687393

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00020596
• Start: 9343333
• End: 9347430
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_9342901..9343332
• Length (nt): 432
• Chromosome Location: X: 9342901-9343332
• Organism: Caenorhabditis elegans

106 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Coexpression clique No. 256, pek-1_22220-pek-1_33, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:pek-1_22220-pek-1_33
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977)
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:sek-1(km4)_downregulated_cisplatin
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	EdgeR v. 3.20.2, fold change > 2.	WBPaper00055941:nuo-6(qm200)_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in pgl-1(ct131) animals (isolated from SS0002[pgl-1(ct131)him-3(e1147)], comparing to in control animals SS1174, at 1-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_pgl-1(ct131)_vs_control_day1-adult
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to tiling array analysis towards total RNA.	A linear model and moderated t-statistic were used to determine differentially expressed genes as implemented by the limma package (v3.21.4). Enriched list contains only genes significantly enriched in the NSM neurons versus the reference <=1.5X and <= 5% FDR.	WBPaper00045974:NSM_enriched_totalRNA_tiling
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA

8 Expression Patterns

• Primary Identifier: Expr6717
• Remark: Strain: BC10915
• Reporter Gene: [T20B5.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAACATTGGTTTTCTTATTCGCAA] 3' and primer B 5' [CTCCATCGTGTTCACAGTCAAT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; hypodermis; Nervous System; tail neurons; unidentified cells in body ; Larval Expression: pharynx; hypodermis; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr12842
• Pattern: An oga-1::GFP reporter construct was expressed in most muscles of the animal including body wall, pharyngeal, vulval and rectal muscles. Expression was also observed in the nerve ring, spermatheca and coelomocytes.

• Primary Identifier: Expr157
• Remark: Other strain-- UL786 (died out)
• Pattern: Occasional strong expression is seen in the excretory cell of larvae and adults. In larvae weak diffuse expression is seen throughout the worm.

• Primary Identifier: Expr1038977
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1026139
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1157162
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2014613
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2032846
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

13 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00020596
• Start: 9343333
• End: 9347430
• Strand: -1

13 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes that showed more than 2 fold decreased expression in oga-1(ok1207) comparing to in N2 when fed with OP50.	The significantly expressed genes were selected based on ANOVA analysis by Partek Genomics Suite software. Genes with a p-value of <0.05 and a 2-fold or greater fold change were considered differentially expressed.	WBPaper00046083:oga-1(ok1207)_OP50_downregulated
	Genes that showed more than 2 fold increased expression in oga-1(ok1207) comparing to in N2 when fed with OP50.	The significantly expressed genes were selected based on ANOVA analysis by Partek Genomics Suite software. Genes with a p-value of <0.05 and a 2-fold or greater fold change were considered differentially expressed.	WBPaper00046083:oga-1(ok1207)_OP50_upregulated

1 Sequence

• Length: 4098

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00037745
• WBStrain00031870
• WBStrain00001564

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_9347431..9349275
• Length (nt): 1845
• Chromosome Location: X: 9347431-9349275
• Organism: Caenorhabditis elegans