WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00000081 Gene Name  ads-1
Sequence Name  ? Y50D7A.7 Brief Description  ads-1 is an ortholog of human AGPS (alkylglycerone phosphate synthase; OMIM:603051) that is required for the biosynthesis of ether lipids; mutation of human AGPS leads to type 3 rhizomelic chondrodysplasia punctata (OMIM:600121).
Organism  Caenorhabditis elegans Automated Description  Predicted to enable FAD binding activity and alkylglycerone-phosphate synthase activity. Predicted to be involved in ether lipid biosynthetic process. Predicted to be located in peroxisome. Human ortholog(s) of this gene implicated in rhizomelic chondrodysplasia punctata type 3. Is an ortholog of human AGPS (alkylglycerone phosphate synthase).
Biotype  SO:0001217 Genetic Position  III :-26.9029 ±0.001546
Length (nt)  ? 2903
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00000081

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:Y50D7A.7.1 Y50D7A.7.1 1879   III: 295654-298556
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:Y50D7A.7 Y50D7A.7 1794   III: 295714-295923

5 RNAi Result

WormBase ID
WBRNAi00001652
WBRNAi00057091
WBRNAi00030217
WBRNAi00007229
WBRNAi00098747

133 Allele

Public Name
gk962532
gk964281
gk963761
WBVar02122373
gk5816
gk880493
WBVar01699887
WBVar01699886
WBVar01699889
WBVar01699888
WBVar01699894
WBVar01699893
WBVar01699896
WBVar01699895
WBVar01699890
WBVar01699892
WBVar01699891
WBVar01699898
WBVar01699897
WBVar01699899
WBVar01699902
WBVar01699901
WBVar01699904
WBVar01699903
WBVar01699900
WBVar01699905
WBVar01699836
WBVar01699835
WBVar01699838
WBVar01699837

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00000081 295654 298556 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

181 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. edgeR, fold change > 2, FDR < 0.05 WBPaper00060909:atfs-1(cmh15)_downregulated
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Genes up regulated in alg-1(gk214) comparing to in N2. Differential expression was assessed using an empirical Bayes statistics using the eBayes function. WBPaper00040823:alg-1(gk214)_upregulated
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  mRNAs that showed differential expression in activated AAK-2(uthIs202[aak-2 (intron 1)::aak-2(aa1-aa321)::Tomato::unc-54 3'UTR + rol-6(su1006)]), activiated CRTC-1 (uthEx222[crtc-1p::crtc-1 cDNA (S76S, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]), or AAK-2;CRTC-1 comparing to in N2. Genes were tested for differential expression between each mutant strain and wild-type using edgeRs glm method. Briefly, negative binomial models were fitted and dispersion estimates obtained. These were then used to calculate average levels of change between conditions and determine differential expression, using the generalized linear model likelihood ratio test. For each comparison, genes with less than 5 CPM were filtered and those with at least 50% change and False Discovery Rate (FDR) of 1% or less were considered differentially expressed. WBPaper00046499:AMPK_regulated
  Transcripts that showed significantly decreased expression in morc-1(tm6048) animals, comparing to in N2, after growing at 25C for five generations (late generation). CuffDiff2 WBPaper00051265:F4_morc-1(tm6048)_downregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals. NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%. WBPaper00064727:daf-2(e1370)_upregulated

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2009241 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1030037 Tiling arrays expression graphs  
Strain: BC11107 [ads-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTAGCACGTTGTAACACGGAAA] 3' and primer B 5' [GATAGGACGCCGAGATTTATTG] 3'. Expr7023 Adult Expression: intestine; Larval Expression: intestine;  
Strain: BC11106 [ads-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTAGCACGTTGTAACACGGAAA] 3' and primer B 5' [GATAGGACGCCGAGATTTATTG] 3'. Expr7024 Adult Expression: intestine; Larval Expression: intestine;  
Original chronogram file: chronogram.1473.xml [Y50D7A.7:gfp] transcriptional fusion. Chronogram464    
    Expr2027478 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1012500 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1160540 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

18 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  located_in

5 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00000081 295654 298556 -1

18 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
2903

1 Sequence Ontology Term