WormMine: Gene WBGene00000182

• WormBase Gene ID: WBGene00000182
• Gene Name: arf-1
• Sequence Name: B0336.2
• Brief Description: arf-1.2 encodes an ADP-ribosylation factor homolog required in vivo for embryonic development, fertility, locomotion, vulval development, and cuticular synthesis; ARF proteins are N-myristoylated GTPases that regulate membrane traffic and the actin cytoskeleton, and that activate both phospholipase D1 (PLD1) and phosphatidylinositol 4-phosphate 5-kinase.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Involved in several processes, including oocyte development; regulation of apoptotic process involved in development; and regulation of receptor-mediated endocytosis. Located in endoplasmic reticulum. Expressed in pharyngeal muscle cell; uterus; ventral nerve cord; and vulval precursor cell. Human ortholog(s) of this gene implicated in periventricular nodular heterotopia. Is an ortholog of human ARF1 (ADP ribosylation factor 1) and ARF3 (ADP ribosylation factor 3).
• Biotype: SO:0001217
• Genetic Position: III :-1.44726 ±0.000356
• Length (nt): 2701

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000182

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:B0336.2.2	B0336.2.2	1308	III: 5714886-5717586
Transcript:B0336.2.1	B0336.2.1	1173	III: 5716115-5717544

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:B0336.2	B0336.2	546	III: 5716116-5716263

38 RNAi Result

• WBRNAi00085364
• WBRNAi00098332
• WBRNAi00024381
• WBRNAi00008295
• WBRNAi00109160
• WBRNAi00028094
• WBRNAi00080008
• WBRNAi00062560
• WBRNAi00001184
• WBRNAi00083356
• WBRNAi00109549
• WBRNAi00080493
• WBRNAi00002442
• WBRNAi00002820
• WBRNAi00038944
• WBRNAi00062565
• WBRNAi00080007
• WBRNAi00087057
• WBRNAi00087059
• WBRNAi00087058
• WBRNAi00079473
• WBRNAi00079519
• WBRNAi00079657
• WBRNAi00079703
• WBRNAi00079795
• WBRNAi00079565
• WBRNAi00079611
• WBRNAi00079749
• WBRNAi00109258
• WBRNAi00087060

33 Allele

• gk964518
• gk175265
• gk175266
• gk175267
• gk175268
• gk175269
• gk964338
• gk964339
• WBVar01263844
• WBVar01710115
• WBVar01710116
• WBVar01644797
• WBVar02015256
• gk566880
• gk371473
• gk804184
• gk549770
• gk363524
• gk515989
• gk747463
• gk926409
• gk604924
• gk619077
• gk875182
• gk397613
• gk919714
• WBVar00061472
• WBVar01995260
• gk758004
• gk427969

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000182
• Start: 5714886
• End: 5717586
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_5717587..5719646
• Length (nt): 2060
• Chromosome Location: III: 5717587-5719646
• Organism: Caenorhabditis elegans

132 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly decreased expression in dissected female germline comparing to in dissected male germline.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:female_vs_male_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Transcripts that were regulated by both set-6(ok2195) and baz-2(tm0235) at 2-day post L4 adult hermaphrodite stage.	N.A.	WBPaper00059356:set-6(ok2195)_baz-2(tm0235)_regulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L2-larva_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes

10 Expression Patterns

• Primary Identifier: Expr4834
• Remark: Picture: Figure 1D III and IV.
• Pattern: B0336.2 is able to drive GFP expression in the pharynx, gut, and head neurons.

• Primary Identifier: Expr5055
• Remark: Also expressed in (comments from author) : possibly labial sensillia in head. Hard to see because GFP in other tissues is masking things. Strain: BC12796
• Reporter Gene: [arf-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCCGTTTATTATTGTTGCCTAT] 3' and primer B 5' [CCGAACACGTTTCCGATT] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; labial sensilla; neurons along body; tail neurons; Larval Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; Nervous System; head neurons; labial sensilla; tail neurons

• Primary Identifier: Expr2009391
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1030106
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr3149
• Pattern: Arf-1::GFP or Arf1::gfp expression was first detectable in very young embryos with as few as 48-64 cells. Expressed in the ventral nerve cord, vulva, intestine, and body wall and pharyngeal muscle tissues. Arf-1::GFP was clearly seen in the uterus, spermatheca, and gonadal sheath,

• Primary Identifier: Expr15679
• Subcellular Localization: ARF-1::EGFP localizes to cytoplasmic foci when expressed in the VPCs (O Skorobogata and CER, unpublished results). We found that LIN-10 frequently colocalizes with ARF-1 cytoplasmic foci or can localize to adjacent foci at Pn.p and Pn.px stages. See also [Expr15678].

• Primary Identifier: Expr2027627
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1028066
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1686
• Remark: Original chronogram file: chronogram.607.xml
• Reporter Gene: [B0336.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1143124
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

20 GO Annotation

25 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000182
• Start: 5714886
• End: 5717586
• Strand: 1

20 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2701

1 Sequence Ontology Term