WormMine: Gene WBGene00000430

• WormBase Gene ID: WBGene00000430
• Gene Name: ceh-5
• Sequence Name: C16C2.1
• Brief Description: ceh-5 encodes a homeodomain protein, similar to the human VENTRAL ANTERIOR HOMEO BOX 2 gene (VAX2; OMIM:604295); CEH-5 is dispensable for viability and gross morphology.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in brain development; neuron differentiation; and regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. Expressed in several structures, including coelomocyte; head muscle; somatic nervous system; tail; and terminal bulb. Human ortholog(s) of this gene implicated in syndromic microphthalmia 11. Is an ortholog of human VAX1 (ventral anterior homeobox 1).
• Biotype: SO:0001217
• Genetic Position: I :3.88059 ±0.003921
• Length (nt): 866

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000430

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C16C2.1.1	C16C2.1.1	600	I: 9727169-9728034

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C16C2.1	C16C2.1	405	I: 9727217-9727360

3 RNAi Result

• WBRNAi00040688
• WBRNAi00040689
• WBRNAi00002957

17 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• h7934
• WBVar01432607
• WBVar00156066
• WBVar01957569
• gk763633
• WBVar01910179
• gk477752
• gk119359
• gk119355
• gk119356
• gk119357
• gk119358
• tm1403

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000430
• Start: 9727169
• End: 9728034
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_9728035..9731347
• Length (nt): 3313
• Chromosome Location: I: 9728035-9731347
• Organism: Caenorhabditis elegans

92 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
Bacteria infection: Photorhabdus luminescens	Genes down-regulated in animals infected with Photorhabdus luminescens compared to the E. coli OP50 control after 24h of infection.	MAANOVA and BRB-Array-Tools.	WBPaper00030985:Photorhabdus_luminescens_downregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
	Transcripts that showed significantly decreased expression in mdt-15(mg584gf) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:mdt-15(mg584)_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector.	DESeq2. FDR < 0.05.	WBPaper00060459:bcat-1(RNAi)_downregulated
	Transcripts that showed significantly increased expression in spr-1(ok2144) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:spr-1(ok2144)_upregulated
	Transcripts that showed significantly increased expression in sams-3(RNAi) comparing to N2 animals injected with empty vector.	Deseq FDR < 0.01, fold change > 2.	WBPaper00065005:sams-3(RNAi)_upregulated
	Transcripts that showed significantly increased expression in sams-4(RNAi) comparing to N2 animals injected with empty vector.	Deseq FDR < 0.01, fold change > 2.	WBPaper00065005:sams-4(RNAi)_upregulated
	Genes that showed decreased expression after 1-methylnicotinamide (MNA) treatment.	Raw counts for the genes were analyzed using the R Statistical Computing Environment and the Bioconductor packages DESeq and edgeR. Both packages provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate (FDR). If both FDR values (by DESeq and edgeR) were smaller than p = 0.05, genes were assigned as differentially expressed.	WBPaper00044260:1-methylnicotinamide_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_upregulated
	Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C.	N.A.	WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 20C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_20C_upregulated
	Total muscle depleted genes (complete list of non-overlapping genes from the 0hr and 24hr muscle depleted datasets).	A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets.	WBPaper00031003:total_muscle_depleted
	Genes that showed significantly decreased experssion after 22.5 hours of treatment in 200nM delta7-dafachronic acid comparing with in ethanol vehicle control.	To identify the differentially expressed genes, we applied Significance Analysis of Microarrays (SAM) analysis using the R package samr [46]. Genes with median false discovery <5% and fold changes >2.0 were considered differentially expressed.	WBPaper00046548:dafachronic-acid_downregulated
	Transcripts that showed significantly increased expression in ints-1(RNAi) animals comparing to control RNAi animals, at late L3 larva stage.	DESeq2, v1.12.0, fold change > 2, FDR < 0.05	WBPaper00057068:ints-4(RNAi)_upregulated
	Transcripts up regulated in daf-2(e1370) comparing to in N2 when animals were grown at 15 degree and then at 25 degree for 12 hours.	To select nuclear-hormone-receptor mutants for the cold-tolerance test, authors set the q-value threshold at q < 0.05, except that nhr-88, 113, 145, 172 and 207 were picked up from the genes with q < 0.25 in comparing between 15C-cultivated wild-type and wild-type cultivated at 25C for 12 h after cultivation at 15C.	WBPaper00049736:daf-2(e1370)_upregulated_15deg-then-25deg(12hr)
	Genes that showed flat mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:flat_dev_expression
	Down-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2.	Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off.	WBPaper00045774:clk-1_downregulated
	Transcripts that showed significantly decreased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_downregulated
	Gene transcripts in this set are up-regulated at 5% FDR between L4 lethargus and L4 AND between L4 lethargus and 4-hour old adults.	Analysis of variance (ANOVA) methods were used to determine differential gene expression using the R/maanova package.	WBPaper00045960:L4-lethargus_upregulated
	Transcripts that showed significantly increased expression in diploid N2 animals after exposure to 5 uM doxorubicin for 72 hours at 15C from L1 to L4 larve stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:Doxorubicin_upregulated_diploid
25C vs. 20C	Transcripts that showed significantly decreased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_downregulated
Fungi infection: Drechmeria coniospora	Genes with decreased expression after 12 hours of infection by D.coniospora Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:D.coniospora_12hr_downregulated_RNAseq
	Transcripts that showed significantly decreased expression after treated with 300uM CdCl2 from L1 to late L3 larva stage, in N2 animals injected with empty RNAi vector.	DESeq2, v1.12.0, fold change > 2, FDR < 0.05	WBPaper00057068:Cadmium_downregulated

10 Expression Patterns

• Primary Identifier: Expr5281
• Remark: Also expressed in (comments from author) : Notes have been lost. 2 images taken and posted, appears neural. Strain: BC10763
• Reporter Gene: [ceh-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCAGTATCCTCTGCATCGGT] 3' and primer B 5' [GTATCGGCAGAAGGGATAGTTG] 3'.
• Pattern: Larval Expression: Nervous System; nerve ring; head neurons

• Primary Identifier: Expr2009896
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1030243
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr7436
• Remark: Clone: pUL#JRH8H4
• Pattern: Early embryos show GFP expression in two sets of cells that are laterally located. Comma stage embryos have expression in 4 to 6 cells at the anterior. From late embryogenesis to adult, expression is seen in 4 to 6 nerves in the head, two nerves in the tail and in the dorsal and ventral nerve cords. Weak expression is seen in head muscle and intestine.

• Primary Identifier: Expr15182
• Pattern: In wild type L1 larvae, ceh-5p::GFP showed robust expression in head muscles, a subset of head neurons (including the RME neurons), and five or six cells in the tail including the PVQL/R neurons. Weak ceh-5p::GFP expression was also seen in the coelomocytes and the pharyngeal terminal bulb.

• Primary Identifier: Expr2028136
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1144732
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1014792
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1170054
• Pattern: Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191

• Primary Identifier: Expr15593

11 GO Annotation

13 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000430
• Start: 9727169
• End: 9728034
• Strand: 1

11 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 866

1 Sequence Ontology Term