WormMine: Gene WBGene00000446

• WormBase Gene ID: WBGene00000446
• Gene Name: ceh-23
• Sequence Name: ZK652.5
• Brief Description: ceh-23 encodes a homeodomain protein required for a specific differentiated trait of the thermosensory interneuron AIY; a ceh-23::gfp promoter fusion is expressed in nine pairs of head neurons, including seven amphid sensory neurons, the BAG sensory neurons, AIY interneurons, and the CAN neurons that are in close association with the excretory canal.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in determination of adult lifespan; neuron differentiation; and positive regulation of transcription by RNA polymerase II. Located in nucleus. Expressed in intestine; nervous system; and tail.
• Biotype: SO:0001217
• Genetic Position: III :-0.563901 ±0.005495
• Length (nt): 1900

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000446

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK652.5.1	ZK652.5.1	1044	III: 7839592-7841491

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK652.5	ZK652.5	918	III: 7839594-7839666

7 RNAi Result

• WBRNAi00113225
• WBRNAi00059619
• WBRNAi00022105
• WBRNAi00005631
• WBRNAi00038397
• WBRNAi00112995
• WBRNAi00113116

22 Allele

• gk964518
• gk963887
• WBVar01995556
• gk818636
• gk179043
• gk543728
• WBVar01408921
• gk558813
• gk872494
• ms23
• gk955830
• gk444101
• gk847741
• WBVar01446893
• WBVar01446894
• WBVar01838146
• gk179040
• gk179039
• gk179042
• gk179041
• WBVar01995557
• WBVar00236668

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000446
• Start: 7839592
• End: 7841491
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_7841492..7842134
• Length (nt): 643
• Chromosome Location: III: 7841492-7842134
• Organism: Caenorhabditis elegans

101 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_downregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts that showed significantly increased expression in lin-22(ot269) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(ot269)_upregulated
	Transcripts depleted in RIS neurons comparing to in all cells.	edgeR 3.24.3, FDR < 0.01	WBPaper00058969:RIS_depleted
	Transcripts that showed significantly increased expression in nuo-6(qm200);atfs-1(gk3094) comparing to in N2.	EdgeR v. 3.20.2, fold change > 2.	WBPaper00055941:nuo-6(qm200);atfs-1(gk3094)_upregulated
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food.	Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the 3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food).	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:control_vs_UVC-EtBr-exposed_51h
	Significantly upregulated genes from cyc-1(RNAi) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:cyc-1(RNAi)_upregulated
	Transcripts that showed significantly increased expression in lin-22(icb38) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(icb38)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin-Allantoin_downregulated
Bacteria infection: Photorhabdus luminescens	Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:P.lumniescens_24hr_upregulated_TilingArray

12 Expression Patterns

• Primary Identifier: Expr1163024
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2009870
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr9598
• Reporter Gene: [CEH-23::GFP] translational fusion. A 10.3 Kbp genomic fragment containing the 7.3 Kbp sequence upstream of the ceh-23 coding region, the 1.8 Kbp ceh-23 coding region, and the 1.1 Kbp sequence downstream of the ceh-23 coding region was amplified from genomic DNA by PCR. A GFP coding sequence without stop codon was amplified by PCR from the plasmid pPD95-81. The amplified GFP sequence was then fused in frame at the N-terminal of the ceh-23 coding region into the 10.3 Kbp genomic fragment described above. --precise ends.
• Pattern: The expression of CEH-23::GFP was restricted to a handful of neurons and the intestine of the worm. Although the neurons in which CEH-23 is expressed have not been identified, the observed neuronal expression of the CEH-23::GFP construct resembles that of a previously published GFP construct fused to a partial CEH-23 (gmIs18[ceh-23::gfp]), which was reported to express in the pair of CAN neurons in the central body and 12 sets of sensory neurons in the head (10 pairs) and the tail (2 pairs). While the neuronal expression of CEH-23 was found in all the transgenic worms, the intestinal expression was only detected in ,50% of the transgenic worms with a stronger expression in the posterior intestine. The expression of CEH-23::GFP was restricted to a handful of neurons and the intestine of the worm. Although the neurons in which CEH-23 is expressed have not been identified, the observed neuronal expression of the CEH-23::GFP construct resembles that of a previously published GFP construct fused to a partial CEH-23 (gmIs18[ceh-23::gfp]), which was reported to express in the pair of CAN neurons in the central body and 12 sets of sensory neurons in the head (10 pairs) and the tail (2 pairs). While the neuronal expression of CEH-23 was found in all the transgenic worms, the intestinal expression was only detected in 50% of the transgenic worms with a stronger expression in the posterior intestine.
• Subcellular Localization: Enriched nuclear localization of CEH-23 was detected in both the neurons and the intestine.

• Primary Identifier: Expr7764
• Remark: Clone: pUL#JRH5F1
• Pattern: Expression is seen from late embryo to adult in about 10 cells in the nerve ring; processes to the tip of the head; and two nerves down sides of the body (perhaps canal-associated nerves).

• Primary Identifier: Expr15575

• Primary Identifier: Expr7241
• Remark: Strain: BC12624
• Reporter Gene: [ceh-23::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACACCCGAATTATTTGTTCATT] 3' and primer B 5' [GAAGATGGGTGTCGATCTAGAAA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; unidentified cells in tail ; Larval Expression: intestine - posterior cells; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr10084
• Remark: Table S1A.
• Pattern: Expressed in AIY.

• Primary Identifier: Expr12344
• Pattern: Animals bearing a Pceh-23::gfp transgene expressed GFP in the CANs and in several sensory neurons located in the head and tail.

• Primary Identifier: Expr1021192
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2028110
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram711
• Remark: Original chronogram file: chronogram.1742.xml
• Reporter Gene: [ZK652.5:gfp] transcriptional fusion.

• Primary Identifier: Expr1170035
• Pattern: Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191

14 GO Annotation

26 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000446
• Start: 7839592
• End: 7841491
• Strand: 1

14 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that were repressed by CEH-23 by comparing expression between isp-1(qm150) and ceh-23(ms23);isp-1(qm150).	Identified by 1 class SAM with FDR=0.59, 1.5 fold gene cutoff.	WBPaper00051304:CEH-23_repressed
	Transcripts that were activated by CEH-23 by comparing expression between isp-1(qm150) and ceh-23(ms23);isp-1(qm150).	Identified by 1 class SAM with FDR=0.59, 1.5 fold gene cutoff.	WBPaper00051304:CEH-23_activating

1 Sequence

• Length: 1900

1 Sequence Ontology Term