WormMine: Gene WBGene00000915

• WormBase Gene ID: WBGene00000915
• Gene Name: hsp-90
• Sequence Name: C47E8.5
• Brief Description: daf-21 encodes a member of the Hsp90 family of molecular chaperones; DAF-21 activity is required for larval development, negative regulation of dauer larva formation, and a number of specific chemosensory behaviors, such as the response to chemicals and odorants detected by the ASE and AWC sensory neurons; a daf-21 sensory defect can be rescued by a cyclic GMP analogue, suggesting that, in regulating chemosensory behaviors, DAF-21 acts at a similar point as the DAF-11 guanylyl cyclase; down-regulation of daf-21 via RNAi results in a small but reproducible reduction in age-1 life span, suggesting that daf-21 is part of a chaperone network required for the extended life span seen in age-1 mutant animals.
• Organism: Caenorhabditis elegans
• Automated Description: Enables several functions, including ATP hydrolysis activity; nuclear glucocorticoid receptor binding activity; and protein phosphatase 5 binding activity. Involved in several processes, including determination of adult lifespan; protein export from nucleus; and response to stress. Located in perinuclear region of cytoplasm and protein-containing complex. Expressed in several structures, including excretory system; germ line; intestine; nerve ring; and pharynx. Human ortholog(s) of this gene implicated in Alzheimer's disease; autoimmune disease (multiple); and gastrointestinal system cancer (multiple). Is an ortholog of human HSP90AB1 (heat shock protein 90 alpha family class B member 1).
• Biotype: SO:0001217
• Genetic Position: V :6.67425 ±0.016137
• Length (nt): 3628

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000915

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C47E8.5.2	C47E8.5.2	2359	V: 14684918-14688545
Transcript:C47E8.5.1	C47E8.5.1	2227	V: 14686160-14688539

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C47E8.5	C47E8.5	2109	V: 14686164-14686313

44 RNAi Result

• WBRNAi00095531
• WBRNAi00113780
• WBRNAi00113779
• WBRNAi00029918
• WBRNAi00106197
• WBRNAi00106278
• WBRNAi00106281
• WBRNAi00106287
• WBRNAi00112442
• WBRNAi00080969
• WBRNAi00080973
• WBRNAi00106356
• WBRNAi00085599
• WBRNAi00112440
• WBRNAi00000158
• WBRNAi00042688
• WBRNAi00097042
• WBRNAi00080974
• WBRNAi00113778
• WBRNAi00113777
• WBRNAi00080968
• WBRNAi00080970
• WBRNAi00063659
• WBRNAi00079530
• WBRNAi00079668
• WBRNAi00079714
• WBRNAi00112444
• WBRNAi00079806
• WBRNAi00079484
• WBRNAi00079576

57 Allele

• gk963271
• gk963706
• gk963301
• gk964458
• gk964459
• gk963796
• WBVar01975504
• otn13393
• WBVar00016890
• tm3133
• p673
• nr2081
• gk792016
• gk819632
• gk800914
• ok1333
• WBVar01775437
• gk254194
• gk254193
• gk957333
• gk254192
• gk254191
• erb71
• gk254202
• gk254201
• gk254200
• gk254199
• gk254198
• gk254197
• gk254196

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000915
• Start: 14684918
• End: 14688545
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_14688546..14688615
• Length (nt): 70
• Chromosome Location: V: 14688546-14688615
• Organism: Caenorhabditis elegans

230 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977)
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite N2 animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed

17 Expression Patterns

• Primary Identifier: Expr5532
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10293
• Reporter Gene: [daf-21::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTTTTAATTTGCTCCAATTTTT] 3' and primer B 5' [GTTCTCGGAGATGGTTCTGG] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Expr1030576
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr8979
• Remark: Picture: Fig 1c, 1d.
• Pattern: AC88, a well-characterised Hsp-90 monoclonal antibody that cross-reacts with C. elegans DAF-21, was used to stain freeze-cracked worms. Very high levels of expression were observed in the gonad and early embryos, suggesting that daf-21 is maternally derived in C. elegans. Expression was also observed in additional tissues including muscle and possibly neurons in the head.

• Primary Identifier: Expr8978
• Remark: Picture: Fig 1a, 1b. Transcriptional reporter gene constructs containing either 2.3 kb or 4.1 kb of daf-21 upstream sequence were generated. Analysis of b-galactosidase staining in these worms demonstrated that both promoters drive similar patterns of gene expression in all life cycle stages. However, in transgenic worms carrying the longer promoter, GFP fluorescence was also observed which was not apparent using the shorter promoter. For this reason, the longer promoter was used in all subsequent constructs.
• Pattern: Staining was evident in most somatic cells of the worm and was particularly prominent in the large gut cells. Staining was also observed in the nerve ring and in neurons.

• Primary Identifier: Expr11139
• Pattern: In wild-type animals, the sole cytosolic HSP90 (DAF-21) in C. elegans is ubiquitously expressed in the pharynx, intestine, pharyngeal nerve ring, body wall muscle, and excretory cell.

• Primary Identifier: Expr9720
• Pattern: The daf-21 promoter led to GFP expression in the excretory system, pharyngeal muscle cells and intestinal cells. Furthermore, sporadic expression could be observed in body wall muscle cells and vulval muscles. In order to confirm the sporadic expression in muscles, we constructed another reporter plasmid, containing a 2.5 kb genomic sequence upstream of the DAF-21 start codon including its first 4 amino acids fused to YFP.The fluorescent tissues corresponded to those of the stable line and the sporadic expression in body wall muscle cells was recapitulated. Additionally, fluorescence in single head neurons was observed.

• Primary Identifier: Expr557
• Remark: Maternal mRNA.
• Pattern: At 1 to 8-cell stage, ubiquitous with stronger staining in P2 or P3. Ubiquitous at 10-cell through bean embryo. Staining in gut, Z2, Z3 and unidentified anterior cells at comma through pretzel stages.

• Primary Identifier: Expr2686
• Pattern: In adult males, daf-21 mRNA was detected in germline cells, similarly as in hermaphrodites, with a strong signal seen in spermatogonia, decreasing signal in spermatocytes, and none in mature sperm. In the embryo comma stage, daf-21 mRNA was strongly detected in cells of the head region and less so in other areas. In the hatched L1 larvae, daf-21 mRNA was mainly distributed in the germline precursor cells Z2 and Z3 and the head region, whereas in the adult hermaphrodite, it was localized uniquely in the germ cells. In the distal arms of the adult hermaphrodite, mitotically dividing germline cells were strongly stained with the antisense probe, but not with the sense probe. As the oocytes matured, the signal strength of the antisense probe seemed to decrease.

• Primary Identifier: Expr2687
• Pattern: In adult hermaphrodites, 608F antigen existed ubiquitously in the cytoplasm of the oogonium and all oocytes. In adult males, the 608F antigen was distributed ubiquitously in the cytoplasm of spermatogonium and spermatocytes. It was previously shown immunohistologically that, for the early larval stages of L1 and L2, the antigen was detected in both Z2 and Z3 cells as well as in somatic cells.
• Subcellular Localization: Distributed ubiquitously in the cytoplasm.

• Primary Identifier: Expr9721
• Subcellular Localization: YFP-DAF-21 was not homogeneously localized within body wall muscle cells. Instead, it exhibited a striated pattern, closely matching the striation of muscle cells.The fluorescence was localized to the space between the dense bodies, clearly excluded from those and the remainder of the I-band. The continuous line of DAF-21-localization between two rows of dense bodies correlates well to the broad A-band, probably even specifically to the M-line, as localization is sharply restricted to the very middle of the A-band. Comparing several cells with different expression levels, it appears that the localization to the M-line can only be observed if expression levels are high, while in cells expressing lower levels of YFP-DAF-21, the fusion protein only localizes to the I-band.

• Primary Identifier: Expr15092
• Remark: Reporter fusion not specified.
• Pattern: HSP-90 and the cochaperones DAF-41, STI-1, and PPH-5 are expressed in most C. elegans cells (Gillan et al., 2009; Richie et al., 2011; Song et al., 2009), and we confirmed their expression in the TRNs.

• Primary Identifier: Expr2010769
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr3193
• Pattern: Without stress induction, hsp90 mRNA levels increased over 10 fold between embryonic and larval stages. While the level of hsp90 mRNA oscillates during larval development, even after adulthood, expression of hsp90 in unstressed animals is always at least twice as strong as the expression in embryos. hsp90 expression in stressed animals showed a very similar expression profile. Embryos expressed the least amount of hsp90 mRNA, while larvae and adults consistently expressed at least three times that seen in embryos. While the pattern of hsp90 expression over development did not change in stressed animals, the amount of mRNA was dramatically increased at most developmental stages. Embryos and early larvae (L1 and L2) increased their hsp90 mRNA three fold in response to stress. While L3 showed no stress induced response that was specific to that developmental stage, L4 animals produced 24 times the amount of hsp90 mRNA in response to stress. Likewise, stressed, adult animals (L5) produced five times more hsp90 mRNA than unstressed adults.

• Primary Identifier: Expr1017095
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2029006
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1146678
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1642
• Remark: Original chronogram file: chronogram.525.xml
• Reporter Gene: [C47E8.5:gfp] transcriptional fusion.

49 GO Annotation

16 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000915
• Start: 14684918
• End: 14688545
• Strand: 1

49 Ontology Annotations

3 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins with decreased levels in hsp-90(RNAi) nematodes at L4 larva stage.	rotein levels were obtained after comparing the isotope-tagged sample with the non-tagged sample. Averages of two experiments were calculated. A proteins was only included in the final list if several different peptides were quantified for it.	WBPaper00053254:hsp-90(RNAi)_downregulated_protein
	Genes up-regulated > 1.5-fold in C. elegans overexpressing HSP-90		WBPaper00054791:HSP90(neuro)_upregulated
	Proteins with increased levels in hsp-90(RNAi) nematodes at L4 larva stage.	rotein levels were obtained after comparing the isotope-tagged sample with the non-tagged sample. Averages of two experiments were calculated. A proteins was only included in the final list if several different peptides were quantified for it.	WBPaper00053254:hsp-90(RNAi)_upregulated_protein

1 Sequence

• Length: 3628

1 Sequence Ontology Term