WormMine: Gene WBGene00000960

• WormBase Gene ID: WBGene00000960
• Gene Name: dgk-3
• Sequence Name: F54G8.2
• Brief Description: dgk-3 encodes a diacylglycerol kinase that is the C. elegans ortholog of mammalian DGK-beta; dgk-3 activity is required for regulation of long-term thermotactic behavioral plasticity and for regulation of olfactory adaptation; large-scale expression studies have reported dgk-3 expression in head neurons, the intestine, and the pharyngeal lumen, while expression profiling indicates that dgk-3 is expressed in the AFD thermosensory neurons as well as a small number of additional sensory neurons.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ATP-dependent diacylglycerol kinase activity. Involved in olfactory behavior; regulation of long-term neuronal synaptic plasticity; and thermotaxis. Predicted to be located in plasma membrane. Expressed in amphid neurons; head; and pharyngeal lumen. Is an ortholog of human DGKA (diacylglycerol kinase alpha); DGKB (diacylglycerol kinase beta); and DGKG (diacylglycerol kinase gamma).
• Biotype: SO:0001217
• Genetic Position: III :0.250771 ±0.010231
• Length (nt): 5129

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000960

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F54G8.2.1	F54G8.2.1	2566	III: 9163068-9168196

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F54G8.2	F54G8.2	2388	III: 9163077-9163125

4 RNAi Result

• WBRNAi00048388
• WBRNAi00015668
• WBRNAi00006163
• WBRNAi00032822

60 Allele

• gk964518
• gk963887
• WBVar00070308
• gk963931
• gk698098
• gk616138
• gk508515
• gk715240
• gk898678
• WBVar01266950
• h17600
• gk660435
• gk447253
• gk348453
• gk906157
• gk555145
• gk374469
• gk748065
• gk440816
• gk399717
• gk359010
• gk507363
• gk874052
• gk954739
• gk359011
• gk590992
• gk731535
• gk467597
• gk818642
• gk578288

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000960
• Start: 9163068
• End: 9168196
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

91 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
Starvation	Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl)	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:starvation_regulated_LowSalt
	Transcripts that showed significantly increased expression in nas-38(ok3407) comparing to in N2.	A feature was classified upregulated if its FDR-corrected p-value was <= 0.05 and fold change was >= 2. Analogously, a gene was classified downregulated if its FDR-corrected p-value was <= 0.05 and fold change was <= -2.	WBPaper00060703:nas-38(ok3407)_upregulated
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts that showed significantly increased expression in lin-22(ot269) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(ot269)_upregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C.	Transcripts that showed significantly decreased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00058948:PA14_downregulated
	Transcripts that showed significantly increased expression in dpy-7(e88) animals comparing to N2 animals.	Authors considered genes differentially expressed if they had a q-value <= 0.05 and a b-value >= 1 or <= -1.	WBPaper00053771:up_at_dpy-7(e88)
	Transcripts that showed significantly increased expression in lin-22(icb38) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(icb38)_upregulated
	Genes with significant increase of expression in NBAS smgl-1(RNAi) comparing to control.	Bioconductor package LIMMA was used to determine differentially expressed genes. The P-values were adjusted for multiple testing with a false-discovery rate (50). Probe sets with fold-change > 1.5 and q-value < 0.05 were used as a cut-off for C. elegans microarrays	WBPaper00042561:smgl-1(RNAi)_upregulated
	Genes found to be regulated in daf-16(mgDf50) by resveratrol treatment with p < 0.01.	N.A.	WBPaper00026929:Resveratrol_regulated_daf-16
Fungi infection: Harposporium sp.	Genes with decreased expression after 24 hours of infection by Harposporium Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:Harposporium_24hr_downregulated_RNAseq
	Transcripts that showed significantly decreased expression in pry-1(mu38) animals comparing to in N2 at L1 larva stage.	DESeq, FDR < 0.05	WBPaper00055626:pry-1(mu38)_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:BAG-neuron_blastula-embryo_expressed
	Transcripts that did not alter expression in smg-1(r910) and smg-1(r910) smg-2(r915) mutants comparing to in N2, but their mRNAs co-purify with SMG-2.	edgeR	WBPaper00053308:SMG-2_associated_NMD(-)_unaltered_ClassII
Temperature Shift: 25C vs 15C for 16 hours at L4 larva stage.	Transcripts that showed significantly increased expression in AFD neurons comparing to in whole animals.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00065158:AFD_enriched

8 Expression Patterns

• Primary Identifier: Expr6186
• Remark: Strain: BC11552
• Reporter Gene: [dgk-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTACTTTGGGTTCTATGCGAA] 3' and primer B 5' [TCCGGTGATAACAACATTTCTG] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; unidentified cells in head; Larval Expression: intestine; Nervous System; head neurons; unidentified cells in head

• Primary Identifier: Expr23
• Remark: pre-hatched embryo(author) = fully-elongated embryo(curator).
• Pattern: About 6 nuclei in the major nerve ring are seen from hatching onwards. The number decreases to 4 by the onset of adulthood. Up to 8 neural nuclei of the head ganglia stain from the pre-hatched embryo stage to adulthood, a few of the cells also showing axonal process staining. Pre-hatched worms also harbour staining at the pharyngeal lumen.

• Primary Identifier: Expr11097
• Pattern: dgk-3 encodes a predicted diacylglycerol kinase and was expressed in both the AFD and AWB neurons. in four of four examined independent transgenic lines, 65% of transgenic animals expressed dgk-3 more strongly in the AFD than in the AWB neurons. Stronger expression in the AFD as opposed to the AWB neurons was further validated by real-time PCR.

• Primary Identifier: Expr2010865
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1152180
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram293
• Remark: Original chronogram file: chronogram.1315.xml
• Reporter Gene: [F54G8.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2029103
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1022527
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

19 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000960
• Start: 9163068
• End: 9168196
• Strand: 1

19 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5129

1 Sequence Ontology Term