WormMine: Gene WBGene00001121

• WormBase Gene ID: WBGene00001121
• Gene Name: dyf-5
• Sequence Name: M04C9.5
• Brief Description: dyf-5 encodes a putative MAP kinase orthologous to human MAK/ICK(OMIM:154235), Chlamydomonas reinhardtii LF4, and Leishmania mexicanaMPK9; DYF-5 negatively regulates cilial length, restricts KAP-1 tomiddle ciliary segments, is required for normal localization of six IFTcomponents, and is required for OSM-3 to comigrate normally with IFTparticles; DYF-5 is also required for dye-filling of amphid and phasmidneurons and for normal chemotaxis, dauer formation, and male mating;DYF-5 is expressed in head neurons (including amphid neurons), tailneurons (including phasmid neurons), CAN cells, excretory canal neurons,posterior lateral ganglion neurons and in many male tail cells; dyf-5mutant cilia are abnormally elongated, either failing to enter theamphid channel or accumulating IFT proteins at their distal ends,whereas DYF-5 overexpression results in truncated cilia; the dyf-5promoter region contains an X-box, predicted to be bound andtranscriptionally activated by DAF-19, and dyf-5 is regulated by DAF-19in vivo; dyf-5 animals are slightly shorter than normal.
• Organism: Caenorhabditis elegans
• Automated Description: Enables protein serine/threonine kinase activity. Involved in cilium organization; protein localization; and regulation of non-motile cilium assembly. Located in neuronal cell body and plasma membrane bounded cell projection. Expressed in lateral ganglion and neurons. Human ortholog(s) of this gene implicated in endocrine-cerebro-osteodysplasia syndrome; juvenile myoclonic epilepsy 10; and retinitis pigmentosa 62. Is an ortholog of human MAK (male germ cell associated kinase).
• Biotype: SO:0001217
• Genetic Position: I :3.7552±
• Length (nt): 5172

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001121

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:M04C9.5b.1	M04C9.5b.1	1789	I: 9359067-9364238
Transcript:M04C9.5a.1	M04C9.5a.1	1494	I: 9359075-9362926

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:M04C9.5a	M04C9.5a	1416	I: 9359153-9359181
CDS:M04C9.5b	M04C9.5b	1470	I: 9359153-9359181

3 RNAi Result

• WBRNAi00050902
• WBRNAi00004031
• WBRNAi00075965

57 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• gk964316
• h13545
• gk963018
• WBVar01432518
• otn8152
• gk118607
• gk118608
• gk118609
• gk118610
• gk118604
• gk118605
• ok1170
• gk118606
• gk118611
• ok1177
• gk118612
• gk118613
• gk775785
• gk118614
• gk866546
• hc183
• gk374043
• gk493014
• gk509414
• WBVar01910050
• gk569213

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001121
• Start: 9359067
• End: 9364238
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

161 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Single-cell RNA-Seq cell group 71_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:71_0
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_18
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Top 300 transcripts enriched in ABalppppppa, ABpraaapppa according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:ASE_parent
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
Reduced humidity (98% relative humidity).	Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_downregulated_microarray
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated

15 Expression Patterns

• Primary Identifier: Expr4591
• Pattern: The full-length dyf-5::gfp construct showed weak GFP expression in many neurons in the head, including amphid and labial sensory neurons and three pairs of neurons in the tail, including the phasmid sensory neurons. In addition, expression was observed in many cells in the male tail.
• Subcellular Localization: This DYF-5::GFP fusion could be detected uniformly in axons, cell bodies, and dendrites. In addition, authors observed strong fluorescence at the transition zones, which connect the cilia with the dendrites, and weak fluorescence uniformly in the cilia.

• Primary Identifier: Expr4592
• Pattern: The full-length dyf-5::gfp construct (see Expr4591) showed weak GFP expression in many neurons in the head, including amphid and labial sensory neurons and three pairs of neurons in the tail, including the phasmid sensory neurons. In addition, expression was observed in many cells in the male tail. The dyf-5ex4::gfp fusion construct essentially showed the same dyf-5 expression pattern, albeit stronger and more restricted to the cell bodies. In addition, DYF-5ex4::GFP could be detected in the CAN cells, neurons associated with the excretory canal and in a pair of neurons in the posterior lateral ganglion.
• Subcellular Localization: This DYF-5::GFP fusion could be detected uniformly in axons, cell bodies, and dendrites. In addition, authors observed strong fluorescence at the transition zones, which connect the cilia with the dendrites, and weak fluorescence uniformly in the cilia.

• Primary Identifier: Expr4639
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr1030716
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6420
• Remark: Strain: BC13611
• Reporter Gene: [M04C9.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTGACGCAAAGTCTCTGAAAG] 3' and primer B 5' [TGATAATTGCAGACAGAAAAGAGG] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids; Larval Expression: intestine; rectal gland cells; hypodermis; Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids

• Primary Identifier: Expr6421
• Remark: Strain: BC15840
• Reporter Gene: [M04C9.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTGACGCAAAGTCTCTGAAAG] 3' and primer B 5' [TGATAATTGCAGACAGAAAAGAGG] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons

• Primary Identifier: Expr10127
• Remark: Promoter::GFP fusion constructs of variable lengths were generated using PCR amplification followed by subsequent cloning into expression vectors.
• Pattern: Expressed in both the amphid and tail ciliated sensory neurons. The 60 C. elegans CSNs present in an adult hermaphrodite worm were divided into 5 subgroups or anatomical regions including, neurons that reside in the amphids (region 1 = 24 CSNs: AWAL/R, AWBL/R, AWCL/R, AFDL/R, ASEL/R, ADFL/R, ASGL/R, ASHL/R, ASIL/R, ASJLR, ASKL/R, ADLL/R) or in the tail (region 2 = 5 CSNs: PHAL/R, PHBL/R, PQR), neurons surrounding the anterior bulb (region 3 = 24 CSNs: BAGL/ R, CEPVL/R, CEPDL/R, IL1L/R, IL2L/R, IL1VL/R, IL2VL/R, IL1DL/R, IL2DL/R, OLLL/R, OLQVL/R, OLQDL/R) or the posterior bulb (region 4 = 5 CSNs: ADEL/R, FLPL/R, AQR) of the pharynx, and neurons in the midbody region of the worm (region 5=2 CSNs: PDEL/R). dyf-5 was detected in all 5 regions.

• Primary Identifier: Expr13718
• Subcellular Localization: The endogenous expression level of DYF-5a is weak in cilia but we detected an enrichment of DYF-5a::GFP fluorescence in the distal segments and ciliary tips.

• Primary Identifier: Expr2011135
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1020068
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram295
• Remark: Original chronogram file: chronogram.1317.xml
• Reporter Gene: [M04C9.5:gfp] transcriptional fusion.

• Primary Identifier: Expr15149
• Subcellular Localization: GFP::DYF-5 fusion protein was specifically enriched in the proximal stalks of AWA cilia in wild-type animals.

• Primary Identifier: Expr15859
• Reporter Gene: cas1057cas891[gfp::dyf-5b::wrmScarlet knock-in] I
• Subcellular Localization: DYF-5 localized in the WT cilia

• Primary Identifier: Expr2029371
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1154598
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

39 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001121
• Start: 9359067
• End: 9364238
• Strand: 1

39 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5172

1 Sequence Ontology Term