WormMine: Gene WBGene00001387

• WormBase Gene ID: WBGene00001387
• Gene Name: far-3
• Sequence Name: F15B9.1
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable lipid binding activity. Expressed in vulva and in male.
• Biotype: SO:0001217
• Genetic Position: V :4.79254 ±0.004559
• Length (nt): 736

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001387

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F15B9.1.1	F15B9.1.1	673	V: 12996787-12997522

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F15B9.1	F15B9.1	570	V: 12996880-12997021

2 RNAi Result

• WBRNAi00044695
• WBRNAi00013357

13 Allele

• gk963271
• gk963301
• gk964458
• gk964459
• WBVar01868795
• gk964058
• WBVar00011545
• ok313
• gk724982
• gk937565
• gk471427
• gk907590
• gk250749

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001387
• Start: 12996787
• End: 12997522
• Strand: -1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

0 Downstream Intergenic Region

444 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults.	Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05.	WBPaper00061530:nhr-49(e2144)_downregulated
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
mitochondrial sulfide delivery molecule (mtH2S) AP39	Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Transcripts that showed significantly decreased expression in prx-5(RNAi) animals.	Fold change > 2, p-value < 0.05.	WBPaper00060911:prx-5(RNAi)_downregulated_mRNA
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
mitochondrial sulfide delivery molecule (mtH2S) AP39	Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from L1 larva until 11-days-post-L4 adult.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:mtH2S-AP39-L1-treatment_upregulated_Day11
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after 24 hours of induction of human beta Amyloid at young adult stage	A 2-fold change in expression level and a false discovery rate analog of p < 0.05.	WBPaper00064130:Beta-Amyloid_24h_upregulated_mRNA
	Transcripts that showed significantly decreased expression in lipl-4 overexpression transgenic lines comparing to wild type control animals.	DESeq2 fold change > 2, FDR < 0.05.	WBPaper00064156:lipl-4(overexpress)_downregulated
	Transcripts that showed significantly increased expression in Y56A3A.22(cck200) and Y56A3A.22(cck201) animals comparing to wild type animals.	N.A.	WBPaper00061045:Y56A3A.22(cck200)_upregulated
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated

11 Expression Patterns

• Primary Identifier: Expr1030832
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5766
• Remark: Strain: BC14852
• Reporter Gene: [far-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACGAAGATCGTTCTATCAGGC] 3' and primer B 5' [CGAGAGATTGTTGATGTTGCTCT] 3'.
• Pattern: Adult Expression: intestine; hypodermis; Larval Expression: intestine; hypodermis

• Primary Identifier: Expr8219
• Remark: Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http: Picture: N.A.
• Pattern: Expressed in intestine and vulval region.

• Primary Identifier: Expr8214
• Remark: Picture: N.A. Reporter gene fusion type not specified.
• Pattern: Expressed in epidermis and intestine.

• Primary Identifier: Expr2011423
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1148666
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr3895
• Pattern: No gfp epxression detected.

• Primary Identifier: Chronogram1038
• Remark: Original chronogram file: chronogram.2097.xml
• Reporter Gene: [F15B9.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2393
• Remark: Type: RT-PCR. sqRT-PCR, using RNA isolated from embryos, L1, L2, L3, and L4 larvae, young adult hermaphrodites, and mixed-stage him-8 mutants that give rise to male-enriched cultures. Transcript levels are presented relative to that of a control transcript, ama-1.
• Pattern: Strong expression (>1.0X of control ama-1 expression): adult male. Weak expression (<0.5X of control ama-1 expression): embryos, L1, L2, L3, and L4 larvae, young adult hermaphrodites.

• Primary Identifier: Expr2029660
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1016109
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001387
• Start: 12996787
• End: 12997522
• Strand: -1

1 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 736

1 Sequence Ontology Term