WormMine: Gene WBGene00001479

• WormBase Gene ID: WBGene00001479
• Gene Name: fmo-4
• Sequence Name: F53F4.5
• Brief Description: fmo-4 encodes a flavin-containing monoxygenase homologous to human FMO1, FMO2, and FMO3 (OMIM:602079, mutated in trimethylaminuria).
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable monooxygenase activity. Predicted to be involved in lipid metabolic process. Predicted to be located in endoplasmic reticulum membrane. Expressed in excretory duct cell; excretory socket cell; hypodermal cell; intestine; and ventral nerve cord. Human ortholog(s) of this gene implicated in hypertension and trimethylaminuria. Is an ortholog of several human genes including FMO2 (flavin containing dimethylaniline monoxygenase 2); FMO3 (flavin containing dimethylaniline monoxygenase 3); and FMO4 (flavin containing dimethylaniline monoxygenase 4).
• Biotype: SO:0001217
• Genetic Position: V :5.5143 ±0.013631
• Length (nt): 3426

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001479

Genomics

2 Transcripts

Class	WormMine ID	Sequence Name	Length (nt)	Chromosome Location
MRNA	Transcript:F53F4.5a.1	F53F4.5a.1	2018	V: 13603276-13606701
NcPrimaryTranscript	Transcript:F53F4.5b	F53F4.5b	1711	V: 13603580-13606694

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F53F4.5a	F53F4.5a	1707	V: 13603580-13603783

10 RNAi Result

• WBRNAi00081487
• WBRNAi00001191
• WBRNAi00048155
• WBRNAi00015527
• WBRNAi00098199
• WBRNAi00061322
• WBRNAi00032707
• WBRNAi00081537
• WBRNAi00114740
• WBRNAi00081512

47 Allele

• gk963271
• gk963706
• gk963301
• gk964458
• gk964459
• WBVar02061996
• gk964026
• tm765
• WBVar01652007
• gk321970
• gk710069
• gk894863
• WBVar00013180
• gk574091
• gk316058
• gk525420
• gk550232
• gk354985
• WBVar00013185
• gk543327
• gk649371
• gk545535
• gk773747
• WBVar00013190
• gk794929
• ok294
• gk348630
• gk370322
• gk543326
• gk251993

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001479
• Start: 13603276
• End: 13606701
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_13602794..13603275
• Length (nt): 482
• Chromosome Location: V: 13602794-13603275
• Organism: Caenorhabditis elegans

243 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated
	Top 300 transcripts enriched in excretory duct, excretory pore according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Excretory_duct_and_pore
	Transcripts enriched in AMso according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:AMso_enriched
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly decreased expression in npr-8(ok1439) animals with 24 hour exposure to P. aeruginosa PA14, comparing to N2 animals with 24 hour exposure to P. aeruginosa PA14.	DESeq2, fold change > 1.5, FDR < 0.05.	WBPaper00058948:npr-8(ok1439)_downregulated_PA14
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Transcripts that showed significantly increased expression in animals with germline-specific inx-14(RNAi) comparing to in aniamls fed with control vector, both exposed to PA14 infection.	DESeq2. Differentially-expressed genes (DEG) were identified based on two criteria: FDR (False discovery rateusing Benjamini-Hochberg adjusted p-values) < 0.01 and absolute value of log2(Fold Change) > 1.	WBPaper00066146:germline-inx-14(RNAi)_upregulated_PA14
	Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:sek-1(km4)_downregulated_cisplatin
	Transcripts that showed significantly decreased expression in strain GC1459 containing daf-18(ok480) comparing to control strain GC1171.	edgeR, p-value < 0.05, fold change > 2.	WBPaper00061699:daf-18(ok480)_downregulated
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated

9 Expression Patterns

• Primary Identifier: Expr1030882
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6160
• Remark: Strain: BC14787
• Reporter Gene: [fmo-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATCATCGAAATTGAGATTGTTGT] 3' and primer B 5' [ACACAGACACGGATTTGAAAACT] 3'.
• Pattern: Adult Expression: intestine - posterior cells; Reproductive System; vulval muscle; hypodermis; Nervous System; head neurons; Larval Expression: intestine - posterior cells; Reproductive System; developing vulva; hypodermis; Nervous System; head neurons

• Primary Identifier: Expr1151968
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr3221
• Pattern: Larval and adult worms transgenic for fmo-4::LacZ exhibited marked uniform beta-Gal expression in the nuclei of cells of the hypodermis. Hypodermal beta-Gal expression was far more pronounced for fmo-4 than other fmos.

• Primary Identifier: Expr12890
• Pattern: In CD1002, transgenic for pMPFG1 (Pfmo-4::GFP) that contains ~4 kb of fmo-4 5' flanking sequence, GFP was expressed diffusely throughout the syncytial hypodermis, including head and tail hyp cells, but was absent from seam cells. Prominent GFP expression was also observed in cells flanking the vulval slit and, most noticeably, in the duct and pore cells just anterior to the posterior bulb of the pharynx. Essentially the same GFP expression was observed in both CD1018, transgenic for the fosmid-based reporter fMW002 (Pfmo-4::fmo-4:: GFP), and BC14787 (rCesF53F4.5::GFP) (McKay et al., 2003) in which the PCR-generated Pfmo-4::GFP transgene drives gfp expression with ~2.5 kb of upstream sequence. GFP expression in the duct and pore cell bodies was clearly visible under higher magnification in all three strains and was also observed in CD1002 and BC14787 outlining the distal section of the excretory duct up to the location of the excretory pore. GFP expression was not observed in the body or canals of the adjacent excretory cell.

• Primary Identifier: Expr13433
• Pattern: fmo-4::gf pwas expressed strongly in hypodermal cells, excluding the seam cells and vulval cells, consistent with previous studies. We also observed fmo-4::gfp expression in cells in the ventral nerve cord.

• Primary Identifier: Expr2011859
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1014325
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2030097
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

14 GO Annotation

27 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001479
• Start: 13603276
• End: 13606701
• Strand: -1

14 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3426

1 Sequence Ontology Term