WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00001491 Gene Name  frm-4
Sequence Name  ? C24A11.8 Brief Description  frm-4 encodes a predicted transmembrane protein that contains an N-terminal FERM (Band 4.1-ezrin-radixin-moesin) domain; by homology, FRM-4 is predicted to function as a membrane-cytoskeleton linker protein that plays a role in cell adhesion, migration, or organization of cell surface structures; however, as loss of frm-4 activity via large-scale RNAi screens does not result in any obvious abnormalities, the precise role of FRM-4 in C. elegans development and/or behavior is not yet known.
Organism  Caenorhabditis elegans Automated Description  Predicted to be involved in actomyosin structure organization. Predicted to be located in cytoskeleton. Expressed in PVDL; PVDR; head; and tail. Human ortholog(s) of this gene implicated in neurodevelopmental disorder with eye movement abnormalities and ataxia. Is an ortholog of human FRMD3 (FERM domain containing 3) and FRMD5 (FERM domain containing 5).
Biotype  SO:0001217 Genetic Position  I :-0.025651 ±0.00187
Length (nt)  ? 9519
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00001491

Genomics

5 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C24A11.8a.2 C24A11.8a.2 2410   I: 5402882-5412400
Transcript:C24A11.8b.2 C24A11.8b.2 2376   I: 5402883-5408344
Transcript:C24A11.8c.1 C24A11.8c.1 2460   I: 5402884-5408342
Transcript:C24A11.8a.1 C24A11.8a.1 2346   I: 5402889-5408344
Transcript:C24A11.8b.1 C24A11.8b.1 2427   I: 5402889-5412400
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C24A11.8b C24A11.8b 1932   I: 5403321-5403455
CDS:C24A11.8c C24A11.8c 2019   I: 5403321-5403455
CDS:C24A11.8a C24A11.8a 1908   I: 5403321-5403455

10 RNAi Result

WormBase ID
WBRNAi00001501
WBRNAi00041048
WBRNAi00114829
WBRNAi00002992
WBRNAi00002993
WBRNAi00002996
WBRNAi00029127
WBRNAi00116825
WBRNAi00117464
WBRNAi00090549

98 Allele

Public Name
gk962706
gk963902
WBVar01431607
WBVar01431606
WBVar01431605
WBVar01694777
gk442380
gk932873
gk341339
gk329939
gk365242
gk368342
gk421261
gk621736
gk518693
gk859407
gk813336
gk406105
gk842127
gk842775
gk893736
gk669804
gk464475
gk322842
gk753538
gk467416
gk523815
gk815750
gk430215
gk515227

1 Chromosome

WormBase ID Organism Length (nt)
I Caenorhabditis elegans 15072434  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00001491 5402882 5412400 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

142 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults. Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05. WBPaper00061530:nhr-49(e2144)_downregulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
  Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage. DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed. WBPaper00048971:daf-16(mgDf50)_downregulated_L1
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Transcripts that showed significantly decreased expression in strain GC1459 containing daf-18(ok480) comparing to control strain GC1171. edgeR, p-value < 0.05, fold change > 2. WBPaper00061699:daf-18(ok480)_downregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. WBPaper00053810:daf-2(e1370)_upregulated
  Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2. Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. WBPaper00053810:nuo-6(qm200)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_L2-larva_expressed
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Genes regulated by DAF-16, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12. Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons. WBPaper00050801:DAF-16_dauer_regulome
  Genes regulated by DPY-21, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12. Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons. WBPaper00050801:DPY-21_dauer_regulome
  Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C. EdgeR, FDR < 0.05, fold change < 0.5. WBPaper00055971:nhl-2(ok818)_25C_upregulated

9 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC12301 [frm-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTCAACTTGCTCCCAACTC] 3' and primer B 5' [TACCCCTGGAAACACGAAAA] 3'. Expr5320 Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; distal tip cell; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ;  
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10475 [frm-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTCAACTTGCTCCCAACTC] 3' and primer B 5' [TACCCCTGGAAACACGAAAA] 3'. Expr5321 Adult Expression: Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; head neurons; tail neurons; Larval Expression: body wall muscle; Nervous System; head neurons;  
    Expr1030892 Tiling arrays expression graphs  
    Expr2011886 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr11988    
Original chronogram file: chronogram.211.xml [C24A11.8:gfp] transcriptional fusion. Chronogram1052    
    Expr1018021 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1145087 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2030124 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

3 GO Annotation

Annotation Extension Qualifier
  located_in
  involved_in
  located_in

8 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
orthologue
orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00001491 5402882 5412400 -1

3 Ontology Annotations

Annotation Extension Qualifier
  located_in
  involved_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
9519

1 Sequence Ontology Term