Genomics
4 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:B0304.1a.2 | B0304.1a.2 |
1158
 |
II: 4518574-4522528 |
| Transcript:B0304.1c.1 | B0304.1c.1 |
1089
|
II: 4519063-4522523 |
| Transcript:B0304.1a.1 | B0304.1a.1 |
1053
|
II: 4519065-4522523 |
| Transcript:B0304.1b.1 | B0304.1b.1 |
1066
|
II: 4519067-4522526 |
Other
3 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:B0304.1a | B0304.1a |
963
|
II: 4519069-4519238 |
| CDS:B0304.1c | B0304.1c |
960
|
II: 4519069-4519238 |
| CDS:B0304.1b | B0304.1b |
975
|
II: 4519069-4519238 |
46 RNAi Result
69 Allele
| Public Name |
|---|
| gk963801 |
| gk963053 |
| r1010 |
| WBVar01603702 |
| WBVar02069252 |
| WBVar01371723 |
| gk141000 |
| gk735732 |
| gk140999 |
| gk576037 |
| gk141002 |
| gk805156 |
| gk141001 |
| gk503199 |
| gk726683 |
| gk140996 |
| gk839337 |
| gk140998 |
| gk680834 |
| gk589272 |
| gk140997 |
| gk551589 |
| gk606923 |
| gk354287 |
| gk955254 |
| gk805645 |
| gk141004 |
| gk687045 |
| gk141003 |
| gk801280 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00001948 | 4518574 | 4522528 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
129 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin-Allantoin_upregulated | |
| Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin_upregulated | |
| Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Psora-Allantoin_upregulated | |
| Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rapamycin-Metformin_upregulated | |
| Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day5_vs_Day1_downregulated | |
| Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2. | DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1. | WBPaper00046012:tdp-1(ok803)_upregulated | |
| Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day11_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00060909:atfs-1(cmh15)_downregulated | |
| Maternal class (M): genes that are called present in at least one of the three PC6 replicates. | A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. | [cgc5767]:expression_class_M | |
| Genes up regulated in alg-1(gk214) comparing to in N2. | Differential expression was assessed using an empirical Bayes statistics using the eBayes function. | WBPaper00040823:alg-1(gk214)_upregulated | |
| Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_age_regulated_aging | |
| Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_regulated_aging | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141) | |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. | Sleuth | WBPaper00051558:aging_regulated | |
| Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
| Gamma irradiation 100 mGY per hour for 72 hours since L1 larva. | Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage. | DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3. | WBPaper00058958:100mGy-irradiation-72h_upregulated |
| Bacteria diet: Lb.rhamnosus | Transcripts that showed significantly decreased expression in animals fed with heterofermentative LAB Lb. rhamnosus, comparing to animals fed with OP50 from day 1 to day 5 adult stage. | fold change > 2 and p value < 0.05 by Students t- test. | WBPaper00065392:Lb.rhamnosus_downregulated |
| Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2. | DESeq 2, fold change > 2, FDR < 0.05. | WBPaper00065581:hpk-1(pk1393)_upregulated | |
| Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. | Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. | WBPaper00061479:hda-1(ne4752)_upregulated | |
| Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed | |
| Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals. | Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. | WBPaper00061479:mep-1(ne4629)_upregulated | |
| Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:hypodermis_L3-L4-larva_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed | |
| Bacteria infection: Pseudomonas aeruginosa PA14. 4 hours at 25C. | Transcripts that showed significantly decreased expression after N2 L4 animals were infected by P. aeruginosa (PA14) bacteria for 24 hours at 25C. | DESeq R package (1.18.0), FDR < 0.05 and fold change > 2. | WBPaper00062184:PA14_downregulated |
| Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. | N.A. | WBPaper00026929:sir-2.1_overexpression_regulated | |
| Transcripts that showed significantly altered expression after 24 hour exposure to nitroguanidine (NQ). | Multivariate permutation tests with random variance model implemented in BRB-Array Tools version 4.5 were performed to infer differentially expressed genes (DEGs). One thousand random permutations were computed per chemical class (i.e., a group of 16 arrays or samples). The confidence level of false discovery rate assessment was set at 80%, and the maximum allowed portion of false-positive genes was 10%. | WBPaper00055899:nitroguanidine_regulated | |
| Transcripts of coding genes that showed significantly increased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_enriched_coding-RNA |
28 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr4922 | bwm, faint and mosaic | |||
| Strain: BC13583 | [hlh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGTGGTGAGACCCAACAT] 3' and primer B 5' [GTTTCCGTGTTGATTTCTGGA] 3'. | Expr5047 | Adult Expression: body wall muscle; Larval Expression: body wall muscle; | |
| Strain: DM13583 | [hlh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGTGGTGAGACCCAACAT] 3' and primer B 5' [GTTTCCGTGTTGATTTCTGGA] 3'. | Expr5048 | Adult Expression: body wall muscle; Larval Expression: body wall muscle; | |
| Expr1031133 | Tiling arrays expression graphs | |||
| Expr1019379 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| CeMyoD is encoded by hlh-1. --wjc | Expr1418 | As previously reported, CeMyoD protein was detected in all of the striated muscles present at hatching . During early larval development CeMyoD protein appeared in the daughters of the M blastomere and was retained for the next four cell divisions. Differentiation of cells in the M lineage begins at this stage (designated 16-M). The 12 cells differentiating into striated body muscles remained positive for CeMyoD. The M-derived coelomocytes, also differentiating at this stage, rapidly lost CeMyoD. The two remaining cells from the 16-M stage divide once, each producing a sex myoblast and a striated muscle cell: CeMyoD was found in the striated muscle cell, but was absent both in sex myoblasts and in their sex muscle descendants. | ||
| 90 cell embryo(author) = 88-cell embryo(curator). CeMyoD :Basic Helix-loop-helix transcription factor. Related to the vertebrate MyoD family that is involved in the regulation of striated muscle cell fate.Vertebrate Homologs: Mammalian factors MyoD, MRF-4, Myf-5, myogenin.Invertebrate Homologs: Drosophila protein "Nautilus", sea urchin "SUM-1". Legacy Data: Author "Seydoux GC" "Krause MW". Date 1995-08. Function: Putative null mutation (cc450) of L. Chen and A.Fire suggests important role for CeMyoD in body wall muscle cell function and morphogenesis. CeMyoD is not required for bwm cell fate determination but is for proper bwm cell differentiation | Expr56 | Antibody staining: Transient nuclear staining in early MS lineage identical to lacZ pattern. Stable nuclear expression begins in the 2 daughters of D at the ~90 cell stage, then C and MS lineages that give rise to body wall muscle cells (bwm). The lone AB bwm appears positive after born. At pretzel stage, nuclear staining in the 6 GLR cells. Staining persists throughout postembryonic development in bwm cells, including post-embryonically born bwm. lacZ reporter gene expression: Multiple constructs with multiple lines. Transient expression in 2 MS daughters and the 4 MS granddaughters. Stable expression begins at ~90 cell stage in two daughters of D. Then on in C, MS lineages that give rise to body wall muscle precursors. At pretzel stage, hlh-1 is also expressed in the 6 GLR cells. positive hybridisation to RNA (in _situ) same as lacZ pattern except RNA appears to go away at bean stage and reappear later in embryogenesis | ||
| Expr7318 | Click the movie links below for interactive 4D movies of a fluorescence reporter. http://glowormnotes.blogspot.com/2009/11/unc-120yfp-transcriptional-fusion.html | |||
| Expr8166 | Expressed in MSxx (muscle and pharynx), Cxpx (Muscle) and Dxx (Muscle).Onset times are: 24 cells(MS), 90 cells(C) and 180 cells(D). | |||
| Feature : WBsf047531. Enhancer region 'enh-1' for hlh-1. | Expr11377 | enh-1 was preferentially active in the posterior C and D lineages in the embryo and in body wall musculature in the adult. | ||
| Feature : WBsf047532. Enhancer region 'enh-2' for hlh-1. | Expr11378 | enh-2 was active in C, D and MS muscle lineages in the embryo and in body wall musculature in the adult. | ||
| Feature : WBsf047534. Enhancer region 'enh-4' for hlh-1. | Expr11379 | enh-4 was active in C, D and MS muscle lineages in the embryo and in body wall musculature in the adult. Expression was detected also in GLR. | ||
| Feature : WBsf047533. Enhancer region 'enh-3' for hlh-1. | Expr11380 | Expressed in body wall musculature. | ||
| Expr11546 | Expressed in body wall muscle precursor cells. | |||
| Expr1200150 | Data from the TransgeneOme project | |||
| hlh-1 is called CeMyoD in the article. | Expr1389 | The pattern of expression in larvae and adults was identical whether assayed by antibody staining or reporter gene. CeMyoD is expressed only in body wall muscle cells. CeMyoD antibody stained in the nuclei of very early embryonic blastomeres at about 120 min postfertilization. Staining initially is seen only in the two daughter cells of the D blastomere. Shortly after, CeMyoD is observed in the two daughters of both C.ap and C.pp. Staining is not seen in any of the embryonic blastomeres that produce other types of tissues, including pharyngeal muscle. | Nuclear staining with the CeMyoD antibody is observed in all descendants of the immunopositive early blastomeres as they continue to divide and ultimately differentiate into body wall muscles. | |
| 50-70 cell embryo(author) = 51-cell embryo(curator). No maternal RNA. | Expr569 | Staining in body muscle precursors at 60-cell through bean embryo. | ||
| Expr10324 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
| Expr10325 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
| Expr10326 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
| Expr13296 | I4 progenitor cells and the newly generated presumptive I4 cell were labeled by the HLH-1 reporter. | |||
| Original chronogram file: chronogram.344.xml | [B0304.1:gfp] transcriptional fusion. | Chronogram1467 | ||
| Expr1143090 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr10493 | Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
| Expr2030738 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr2012499 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Original chronogram file: chronogram.239.xml | [B0304.1:gfp] transcriptional fusion. | Chronogram1267 | ||
| Expr1200160 | Data from the TransgeneOme project |
26 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| involved_in | |
| located_in | |
| enables | |
| enables | |
| acts_upstream_of_or_within | |
| enables | |
| acts_upstream_of_or_within | |
| acts_upstream_of_or_within | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in |
17 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
26 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| involved_in | |
| located_in | |
| enables | |
| enables | |
| acts_upstream_of_or_within | |
| enables | |
| acts_upstream_of_or_within | |
| acts_upstream_of_or_within | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in |
3 Regulates Expr Cluster
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcription factors down regulated by hlh-1(cc561). | N.A. | WBPaper00041222:hlh-1(cc561)_downregulated | |
| Transcription factors that showed significantly incresed expression 2 hours after heat shock HLH-1[KM267] at 34C for 30min. | Genes encoding possible transcription factors that were up-regulated at least 5-fold at 2 hrs post-induction of the specified transcription factor. | WBPaper00028867:HLH-1_induced_TF | |
| Transcription factors up regulated by hlh-1(cc561). | N.A. | WBPaper00041222:hlh-1(cc561)_upregulated |