WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00002193 Gene Name  kin-5
Sequence Name  ? T13H10.1 Brief Description  kin-5 encodes a predicted protein tyrosine kinase that is most closely related to the non-receptor tyrosine kinases Fes/Fps and Fer that contain an SH2 domain and a tyrosine kinase domain (OMIM:190030, murine Fes appears to be required for hemopoietic homeostasis); as loss of kin-5 activity via large-scale RNAi screens does not result in any obvious abnormalities, the precise role of kin-5 in C. elegans development and/or behavior is not yet known.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable protein tyrosine kinase activity. Predicted to be located in plasma membrane.
Biotype  SO:0001217 Genetic Position  IV :4.45577 ±0.00102
Length (nt)  ? 2105
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00002193

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T13H10.1.1 T13H10.1.1 1698   IV: 9967077-9969181
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T13H10.1 T13H10.1 1602   IV: 9967105-9967236

3 RNAi Result

WormBase ID
WBRNAi00053291
WBRNAi00018695
WBRNAi00035550

28 Allele

Public Name
gk964278
gk964078
gk964500
gk962765
h11514
h5780
gk209929
WBVar00191618
gk209928
WBVar02046048
gk739584
gk494729
gk480033
tm4072
gk410033
gk802623
WBVar01795115
gk506075
gk858675
gk611056
gk673454
gk931675
gk856434
gk799328
gk787290
gk787289
WBVar01856493
WBVar01856492

1 Chromosome

WormBase ID Organism Length (nt)
IV Caenorhabditis elegans 17493829  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00002193 9967077 9969181 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_9966651..9967076   426 IV: 9966651-9967076 Caenorhabditis elegans

156 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_upregulated
Heat shock: 35C for 1 hour. Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour. The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01. WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression after 24 hours of induction of human beta Amyloid at young adult stage A 2-fold change in expression level and a false discovery rate analog of p < 0.05. WBPaper00064130:Beta-Amyloid_24h_upregulated_mRNA
  Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage. EdgeR, fold change > 2, FDR < 0.001. WBPaper00056290:hsp-6(mg585)_downregulated
  Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). CuffDiff2 WBPaper00051265:F4_hrde-1(tm1200)_upregulated
  mRNAs that showed increased expression in P-granule RNAi animales (simultaneously targeting pgl-1, pgl-3, glh-1 and glh-4) comparing to in control RNAi animals. Set 1 transcripts were defined as P-value < 0.05 and fold change > 2. DESeq was used. Fold change between the average of the four control replicates and the average of the four test replicates was used to calculate the significance using a negative binomial distribution. An adjusted P-value was calculated using the Benjamini-Hochberg method for multiple testing correction. WBPaper00046805:P-granule-RNAi_upregulated_Set1
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in Day 5 (5-days post-L4) vs. Day 0 (L4 larva) of adulthood N2 animals. Differential expression for both small RNA- and mRNA-seq data was tested using DESeq2; P-values were adjusted for multiple testing by Benjamini-Hochberg method. WBPaper00053318:Aging_downregulated_mRNA_N2
  Transcripts that showed significantly decreased expression in mir-71(n4115) comparing to in N2 at 4-days post L4 adult hermaphrodite. Differential expression for both small RNA- and mRNA-seq data was tested using DESeq2; P-values were adjusted for multiple testing by Benjamini-Hochberg method. WBPaper00053318:mir-71(n4115)_downregulated_mRNA
  Transcripts that showed significantly decreased expression in dissected female germline comparing to in dissected male germline. Log2 Fold change > 2 or <-1, p-value < 0.05. WBPaper00053599:female_vs_male_downregulated
  Genes that showed increased expression after nicotic acid (NA) treatment. Raw counts for the genes were analyzed using the R Statistical Computing Environment and the Bioconductor packages DESeq and edgeR. Both packages provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate (FDR). If both FDR values (by DESeq and edgeR) were smaller than p = 0.05, genes were assigned as differentially expressed. WBPaper00044260:nicotinc-acid_upregulated
  Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite npr-8(ok1439) animals grown at 25C, comparing to in N2 animals. CuffDiff, fold change > 2. WBPaper00065096:npr-8(ok1439)_upregulated_Day10_25C
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C. Transcripts that showed significantly increased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14. DESeq2, fold change > 2, FDR < 0.05. WBPaper00058948:PA14_upregulated
Temprature shift to 28C for 24 hours. Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_24h_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:sek-1(km4)_downregulated_cisplatin
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Transcripts that showed significantly increased expression in pie-1(ne4443[PIE-1-Degron-GFP]) DESeq2. Differentially expressed genes were defined as twofold change and adjusted p-value less than 0.05. WBPaper00061478:pie-1(ne4433)_upregulated
  Transcripts that showed significantly increased expression in hda-1[KKRR] in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4747)_upregulated
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:mep-1(ne4629)_upregulated
  Transcripts that showed significantly increased expression in prg-1(tm872) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:prg-1(tm872)_upregulated

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11864 [kin-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGGTCCAGTTTTTACTGCTCAT] 3' and primer B 5' [TGACTGATTGCTCTGAAAAGGA] 3'. Expr6690 Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons; unidentified cells;  
Original chronogram file: chronogram.1329.xml [T13H10.1:gfp] transcriptional fusion. Chronogram308    
    Expr2012944 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1015252 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1156877 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2031176 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

10 GO Annotation

Annotation Extension Qualifier
  involved_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables

12 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00002193 9967077 9969181 -1

10 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
2105

1 Sequence Ontology Term