WormMine: Gene WBGene00002694

• WormBase Gene ID: WBGene00002694
• Gene Name: let-502
• Sequence Name: C10H11.9
• Brief Description: let-502 encodes a Rho-binding Ser/Thr kinase orthologous to human myotonic dystrophy kinase (DM-kinase); let-502 is required for early embryonic cleavages, embryonic elongation, migration of hypodermal P cells to a ventral position, normal spermathecal contraction, and fertility; LET-502 is required for hypodermal cells to properly change their shape, and is expressed in those cells, during embryonic elongation; let-502 mutations are suppressed by mel-11 mutations, and the pattern of LET-502 expression in the embryonic epidermis and the spermatheca is opposite to that of MEL-11, indicating that LET-502 and MEL-11 have opposing functions (presumably tissue contraction and relaxation); MEL-11 requires LET-502 (along with the nonmuscle myosin NMY-1) for proper localization.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable Rho-dependent protein serine/threonine kinase activity. Involved in several processes, including embryonic body morphogenesis; nematode pharyngeal gland morphogenesis; and nematode pharynx development. Located in adherens junction; contractile muscle fiber; and nucleus. Expressed in several structures, including P3.p hermaphrodite; Z2; Z3; gonad; and hypodermis. Is an ortholog of human ROCK1 (Rho associated coiled-coil containing protein kinase 1) and ROCK2 (Rho associated coiled-coil containing protein kinase 2).
• Biotype: SO:0001217
• Genetic Position: I :-0.750734 ±0.004963
• Length (nt): 6151

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002694

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C10H11.9.1	C10H11.9.1	4366	I: 4738171-4744321

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C10H11.9	C10H11.9	3522	I: 4738955-4739136

62 RNAi Result

• WBRNAi00114073
• WBRNAi00114152
• WBRNAi00114231
• WBRNAi00107719
• WBRNAi00064011
• WBRNAi00065137
• WBRNAi00024535
• WBRNAi00000007
• WBRNAi00077061
• WBRNAi00067188
• WBRNAi00067482
• WBRNAi00067562
• WBRNAi00067585
• WBRNAi00067628
• WBRNAi00067786
• WBRNAi00067803
• WBRNAi00067883
• WBRNAi00067897
• WBRNAi00068021
• WBRNAi00024536
• WBRNAi00109231
• WBRNAi00116154
• WBRNAi00108284
• WBRNAi00092706
• WBRNAi00092386
• WBRNAi00085811
• WBRNAi00109619
• WBRNAi00081403
• WBRNAi00114267
• WBRNAi00114032

86 Allele

• gk962706
• gk963902
• gk964159
• gk964070
• gk962802
• sb95
• sb103
• sb93
• sb108
• sb109
• sb106
• sb107
• sb118
• WBVar01431459
• WBVar01431461
• WBVar01694756
• gk712569
• gk932866
• gk925711
• gk391577
• gk383838
• gk718255
• gk878425
• gk376020
• gk815207
• gk924635
• gk439803
• gk322105
• gk440695
• gk831190

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002694
• Start: 4738171
• End: 4744321
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_4738103..4738170
• Length (nt): 68
• Chromosome Location: I: 4738103-4738170
• Organism: Caenorhabditis elegans

113 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector.	DESeq2. FDR < 0.05.	WBPaper00060459:bcat-1(RNAi)_downregulated
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L1-larva_expressed
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_12
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (FLT) starting at L1 lava stage.	DESeq	WBPaper00053302:alovudine_24h_regulated
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated
	Transcripts that showed significantly increased expression in rgef-1p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:rgef-1p-jmjd-1.2(+)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L1-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L1-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L1-larva_expressed

17 Expression Patterns

• Primary Identifier: Expr5237
• Remark: Strain: BC11515
• Reporter Gene: [let-502::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACCAGATGAGCAATTTTGT] 3' and primer B 5' [CTGCAGCTCGATTTTCGTC] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; unidentified cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; unidentified cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5238
• Remark: Strain: BC10781
• Reporter Gene: [let-502::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACCAGATGAGCAATTTTGT] 3' and primer B 5' [CTGCAGCTCGATTTTCGTC] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; gonad sheath cells; Nervous System; tail neurons; Larval Expression: pharynx; seam cells; unidentified cells in head

• Primary Identifier: Expr1031360
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2740
• Pattern: Expressed in embryo. LET-502 also expressed at the AJs of the developing pharynx and intestine and in the germline precursor cells.
• Subcellular Localization: Prior to elongation, LET-502 and MEL-11 showed extensive colocalization in the cytoplasm with punctate staining at epidermal cell boundaries. As elongation proceeded, LET-502 remained primarily cytoplasmic.

• Primary Identifier: Expr1572
• Remark: Reporter gene fusion type not specified.
• Pattern: Strong expression of let-502 was observed in lateral hypodermal seam cells at the onset of the elongation phase of morphogenesis.Other hypodermal cells in embryo showed weak expression.

• Primary Identifier: Expr667
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Strong expression is observed in the lateral hypodermal seam cells at the onset of the elongation phase of morphogenesis. Other hypodermal cells in the embryo show weaker expression (cells not identified).

• Primary Identifier: Expr666
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: let-502 gfp is expressed strongly in the lateral cells but not detectable in dorsal and ventral epidermis. L4-young adult show weak to intermediate expression in many cells of somatic gonad, such as vulval and sheath cells and the fused uterine seam cell. Strong expression in the two valve-like structures of the spermatheca. Nuclei of seam cells, nuclei of P cells, nuclei of hyp7.
• Subcellular Localization: let-502 is expressed in the nuclei.

• Primary Identifier: Expr13847
• Reporter Gene: COP1226 let-502::degron::eGFP endogenously tagged with GFP strain, was generated by Nemametrix.
• Pattern: LET-502 is only faintly expressed in the spermathecal bag cells and high levels of LET-502 are restricted to the distal neck and sp-ut valve cells. This is distinct from the expression pattern of MLCK-1, which is seen throughout the spermatheca including the distal neck, main bag cells, and sp-ut valve.

• Primary Identifier: Expr1024416
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr10573
• Pattern: Plet-502::gfp was expressed at equal levels in P3.p-P8.p before vulval induction in early to mid-L2 larvae. During vulval induction, Plet-502::gfp was downregulated in the primary descendants of P6.p, while expression gradually increased in the P5.p and P7.p descendants that form the secondary lineage. let-502 expression peaked at the onset of vulval morphogenesis, when highest expression was observed in the secondary cells.

• Primary Identifier: Expr2013061
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1144408
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr15310
• Subcellular Localization: The RSKS-1-GFP, MCM-2-GFP, EIF-1-GFP, LET-502-GFP, RAGA-1-GFP, and GFP-SAC-1 fusion proteins appeared punctate in the epithelial intestine and localized to distinct cytoplasmic puncta resembling endosomes.

• Primary Identifier: Expr11881
• Subcellular Localization: In addition, LET-502 localized to oocyte cell boundaries as they became cellularized in a pattern similar to the MEL-11 and NMY-2 distribution. In wild-type embryos, LET-502 and MEL-11 both localized to cleavage furrows at early stages of furrow ingression and remained there during later stages of ingression. Anti-MEL-11 also faintly stained the central spindle during late anaphase. LET-502 and MEL-11 colocalize at the membrane that surrounds the syncitial nuclei in wild-type gonads.

• Primary Identifier: Expr665
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: let-502 mRNA strongly expressed during embryogenesis, weakly expressed in L1s and moderately during L4 and strong again in adults.

• Primary Identifier: Expr2031293
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1334
• Remark: Original chronogram file: chronogram.258.xml
• Reporter Gene: [C10H11.9:gfp] transcriptional fusion.

39 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002694
• Start: 4738171
• End: 4744321
• Strand: -1

39 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 6151

1 Sequence Ontology Term