WormMine: Gene WBGene00003047

• WormBase Gene ID: WBGene00003047
• Gene Name: lis-1
• Sequence Name: T03F6.5
• Brief Description: lis-1 encodes a microtubule-association protein (MAP) that is orthologous to human LIS1, and Aspergillus nidulans nudF, which mediates nuclear migration along Aspergillus hyphae; in C. elegans lis-1 functions as a dynein regulator whose activity is required for a number of processes, including centrosome separation, spindle assembly, regulation of neurotransmission, and actin cytoskeleton integrity; LIS-1 localizes to the cytoplasm, nucleus, and microtubules.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable dynein complex binding activity and microtubule plus-end binding activity. Involved in several processes, including chiasma assembly; microtubule-based process; and organelle localization. Located in cell cortex; perinuclear region of cytoplasm; and supramolecular complex. Part of cytoplasmic dynein complex. Expressed in several structures, including hermaphrodite gonad; hypodermis; neurons; preanal ganglion; and somatic nervous system. Used to study lissencephaly. Human ortholog(s) of this gene implicated in hepatocellular carcinoma; lissencephaly 1; and schizophrenia. Is an ortholog of human PAFAH1B1 (platelet activating factor acetylhydrolase 1b regulatory subunit 1).
• Biotype: SO:0001217
• Genetic Position: III :21.2122 ±0.000276
• Length (nt): 5547

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003047

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T03F6.5.1	T03F6.5.1	1783	III: 13371164-13376710

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T03F6.5	T03F6.5	1215	III: 13371661-13371734

10 RNAi Result

• WBRNAi00082905
• WBRNAi00007203
• WBRNAi00090799
• WBRNAi00091233
• WBRNAi00091232
• WBRNAi00064279
• WBRNAi00026176
• WBRNAi00002619
• WBRNAi00009104
• WBRNAi00052293

92 Allele

• gk963887
• gk963904
• gk963552
• gk190334
• gk190335
• gk190336
• gk190337
• gk190338
• gk190341
• gk190342
• gk190339
• gk190340
• WBVar00182646
• WBVar00182643
• WBVar00182642
• WBVar00182645
• WBVar00182644
• t1550
• t1698
• gk945208
• WBVar01827990
• WBVar01827991
• WBVar00222346
• WBVar00222345
• h14198
• WBVar00237845
• WBVar01410417
• WBVar01398253
• WBVar01410416
• WBVar02051515

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003047
• Start: 13371164
• End: 13376710
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_13371081..13371163
• Length (nt): 83
• Chromosome Location: III: 13371081-13371163
• Organism: Caenorhabditis elegans

95 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:oocyte_vs_mitosis_upregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L2-larva_expressed
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
Starvation 48 hours at L1 arrest	Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest)	Fold change > 2.	WBPaper00064005:starvation_upregulated_N2_mRNA
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2 at early embryo stage.	DESeq2, FDR < 0.05	WBPaper00058691:sin-3(tm1276)_upregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated

15 Expression Patterns

• Primary Identifier: Expr4248
• Pattern: LIS-1 is expressed in all classes of neurons (GABA, cholinergic, glutamatergic) within the ventral cord of C. elegans.

• Primary Identifier: Expr4604
• Subcellular Localization: The antisera created by WBPaper00029200, as well as anti-LIS-1 antisera provided by Pierre Gonczy's laboratory and commercially available anti-LIS-1 antisera all showed diffuse cytoplasmic staining, but did not show the enrichment at the nuclear envelope of oocytes seen in LIS-1::GFP. This difference may reflect instability of LIS-1 or may be a consequence of overexpression of LIS-1::GFP.

• Primary Identifier: Expr4605
• Remark: Reporter gene fusion type not specified.
• Pattern: The GFP construct was broadly expressed throughout the animal with fluorescence strongest in the seam cells, body wall and pharyngeal muscle, vulval cells, spermatheca, the tail, and many neurons.

• Primary Identifier: Expr4606
• Subcellular Localization: The LIS-1::GFP was diffuse throughout the cytoplasm and strongly localized to the nuclear envelope in oocytes.

• Primary Identifier: Expr1031431
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6580
• Remark: Strain: BC11253
• Reporter Gene: [lis-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGGGTATAAAAGAGAGAAAGACCA] 3' and primer B 5' [TGGACGACACACCCAAATAA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; vulva other; spermatheca; body wall muscle; excretory cell; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; excretory cell; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr2420
• Pattern: The LIS-1::GFP fusion was observed in all major neural processes: the ventral nerve cord as well as dorsal and lateral cords and connecting commissures. Expression was noted in the region of the nerve ring and the preanal ganglion. Young adult stages showed strong expression, in particular non-neural cells including the spermathecal valve and the seam cell syncytium, as well as weaker fluorescence in the uterine wall, hypodermal and intestinal cells.
• Subcellular Localization: neuronal processes

• Primary Identifier: Chronogram730
• Remark: Original chronogram file: chronogram.1761.xml
• Reporter Gene: [T03F6.5:gfp] transcriptional fusion.

• Primary Identifier: Expr1155925
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2013227
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr12318
• Subcellular Localization: GFP::LIS-1 is distributed in the cilium middle segment in ciliated neurons.

• Primary Identifier: Expr1010501
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr15127

• Primary Identifier: Expr3077
• Subcellular Localization: LIS-1 is present throughout the cytoplasm, but is also enriched in discrete subcellular locations. In early one-cell-stage embryos, LIS-1 is typically detected within pronuclei during late prophase, before NEBD would be apparent by DIC microscopy. In favourable specimens, LIS-1 can also be detected at the nuclear periphery during late prophase (two-cell-stage embryo) as well as in the vicinity of chromosomes during prometaphase. LIS-1 is depleted from the centres of microtubule asters during prometaphase, whereas it is enriched throughout the spindle during metaphase and early anaphase. During late anaphase and telophase, LIS-1 staining diminishes on the spindle but becomes enriched in the vicinity of the microtubule asters. Moreover, LIS-1 enrichment becomes apparent at the cell cortex at this stage. The discrete subcellular distributions of LIS-1 are typically more readily detectable in subsequent cell cycles. This is especially true of the nuclear enrichment in prophase, of the spindle enrichment in metaphase and of the cortical localization. Whereas foci of LIS-1 colocalize with the plus end of some astral microtubules, this is not always the case, and many LIS-1 foci are found throughout the microtubule lattice. Therefore, C. elegans LIS-1 is not detected strictly at the plus end of microtubules.

• Primary Identifier: Expr2031458
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

60 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003047
• Start: 13371164
• End: 13376710
• Strand: -1

60 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5547

1 Sequence Ontology Term