WormMine: Gene WBGene00003776

• WormBase Gene ID: WBGene00003776
• Gene Name: nmy-1
• Sequence Name: F52B10.1
• Brief Description: nmy-1 encodes a class II non-muscle myosin heavy chain related to Drosophila zipper, which plays a role in several aspects of embryonic morphogenesis; in C. elegans, NMY-1 is required for embryonic elongation and establishment of normal body morphology; however, nmy-1 functions redundantly with another non-muscle myosin heavy chain gene, nmy-2, during elongation and establishment of normal body morphology; mutations in nmy-1 suppress the hypercontraction phenotype produced by mutations in mel-11, a myosin phosphatase that regulates actomyosin filament contraction; in addition, NMY-1 may partner with MLC-4, myosin light chain 4, during elongation; NMY-1 expression is detected during embryogenesis, particularly at the onset of elongation.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable actin filament binding activity and microfilament motor activity. Involved in several processes, including locomotion; nematode larval development; and regulation of embryonic cell shape. Located in adherens junction and contractile muscle fiber. Expressed in head; hypodermis; and tail. Human ortholog(s) of this gene implicated in several diseases, including aortic aneurysm (multiple); auditory system disease (multiple); and blood platelet disease (multiple). Is an ortholog of human MYH11 (myosin heavy chain 11).
• Biotype: SO:0001217
• Genetic Position: X :-12.6731 ±0.002148
• Length (nt): 8518

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003776

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F52B10.1a.1	F52B10.1a.1	6419	X: 2909527-2918043
Transcript:F52B10.1b.1	F52B10.1b.1	6398	X: 2909528-2918044

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F52B10.1a	F52B10.1a	5892	X: 2909556-2909686
CDS:F52B10.1b	F52B10.1b	5871	X: 2909556-2909686

11 RNAi Result

• WBRNAi00063300
• WBRNAi00063301
• WBRNAi00008825
• WBRNAi00000456
• WBRNAi00047912
• WBRNAi00083933
• WBRNAi00114445
• WBRNAi00032577
• WBRNAi00095384
• WBRNAi00063299
• WBRNAi00114643

107 Allele

• gk963725
• sb92
• sb113
• sb115
• WBVar00076598
• WBVar00076599
• WBVar00076597
• WBVar01979963
• WBVar01822290
• WBVar02026855
• h7298
• gk899683
• gk892044
• gk585476
• gk534882
• gk486504
• gk802727
• gk736145
• gk738214
• gk902823
• gk403260
• gk582711
• gk358056
• WBVar00012581
• gk341901
• gk370685
• gk595780
• gk576874
• gk616905
• gk725089

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003776
• Start: 2909527
• End: 2918044
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_2918045..2918646
• Length (nt): 602
• Chromosome Location: X: 2918045-2918646
• Organism: Caenorhabditis elegans

198 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
Growth temperature	Transcripts that are significantly downregulated at 15C compared to both 25C and 20C, with no statistical difference between 25C and 20C, in worms feeding B. subtilis PY79.	DESeq2 and EdgeR, adjusted p-value < 0.05.	WBPaper00053814:15C_downregulated_PY79
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after hlh-30(tm1978) animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_hlh-30(tm1978)
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
	Transcripts that showed significantly increased expression in animals exposed to Leptomycin B for 20 hours at 25C.	p < 0.01, logFC > 1 or p < 0.01, logFC < -1.	WBPaper00066610:Leptomycin-B_upregulated_25C_20h

7 Expression Patterns

• Primary Identifier: Expr1031765
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6132
• Remark: Strain: BC10103
• Reporter Gene: [nmy-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGGGAACATTGATTAGCAC] 3' and primer B 5' [TGCAGGTCACCGATTTGTTA] 3'.
• Pattern: Adult Expression: anal depressor muscle; Reproductive System; vulval muscle; spermatheca; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: anal depressor muscle; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr1151740
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2738
• Pattern: NMY-1 antisera revealed that it is indeed highly expressed in the lateral epidermis at the onset of elongation. NMY-1 was also present at the adherens junctions (AJs) of the developing pharynx. As elongation proceeded, NMY-1 became more punctate and organized into filamentous-like structures. Embryos of similar stages stained for actin showed a similar pattern, albeit filamentous structures become apparent earlier.

• Primary Identifier: Expr2032581
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2014340
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1544
• Remark: Original chronogram file: chronogram.416.xml
• Reporter Gene: [F52B10.1:gfp] transcriptional fusion.

25 GO Annotation

14 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003776
• Start: 2909527
• End: 2918044
• Strand: 1

25 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 8518

1 Sequence Ontology Term