WormMine: Gene WBGene00003901

• WormBase Gene ID: WBGene00003901
• Gene Name: paa-1
• Sequence Name: F48E8.5
• Brief Description: paa-1 encodes the sole C. elegans homolog of PR65, the structural subunit of protein phosphatase 2A (PP2A); paa-1 is an essential gene, required in RNAi assays for embryonic viability, fertility, and cuticular integrity; PAA-1 protein physically interacts with LET-92, the PP2A catalytic subunit, and with RSA-1, a PP2A regulatory subunit; PAA-1 also physically interacts with SMG-5; PAA-1 localizes to centrosomes, the mitotic spindle, P granules, and the nuclear envelope; PAA-1 levels at the centrosome are decreased in rsa-1 mutant animals.
• Organism: Caenorhabditis elegans
• Automated Description: Enables DEAD/H-box RNA helicase binding activity. Involved in embryo development. Located in P granule; microtubule cytoskeleton; and nuclear envelope. Part of protein phosphatase type 2A complex. Human ortholog(s) of this gene implicated in autosomal dominant intellectual developmental disorder 36 and lung cancer. Is an ortholog of human PPP2R1A (protein phosphatase 2 scaffold subunit Aalpha) and PPP2R1B (protein phosphatase 2 scaffold subunit Abeta).
• Biotype: SO:0001217
• Genetic Position: III :-1.65971 ±0.012666
• Length (nt): 2408

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003901

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F48E8.5.1	F48E8.5.1	2159	III: 5450730-5453137

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F48E8.5	F48E8.5	1773	III: 5450741-5451249

25 RNAi Result

• WBRNAi00068232
• WBRNAi00078387
• WBRNAi00047754
• WBRNAi00111732
• WBRNAi00071699
• WBRNAi00025552
• WBRNAi00002814
• WBRNAi00069368
• WBRNAi00069369
• WBRNAi00091027
• WBRNAi00032489
• WBRNAi00071279
• WBRNAi00071280
• WBRNAi00002451
• WBRNAi00080613
• WBRNAi00088793
• WBRNAi00115358
• WBRNAi00085450
• WBRNAi00115360
• WBRNAi00115362
• WBRNAi00115364
• WBRNAi00088801
• WBRNAi00115366
• WBRNAi00008818
• WBRNAi00047753

35 Allele

• gk964518
• gk964338
• gk964339
• gk962643
• WBVar01263633
• tm655
• h15436
• gk174744
• gk174743
• ok1539
• gk174745
• WBVar01644721
• gk174740
• gk174739
• gk174742
• gk174741
• gk877196
• gk451414
• gk707065
• gk510731
• fd134
• gk681543
• gk604155
• gk953275
• gk409998
• gk804178
• gk322261
• gk429670
• gk459870
• gk869674

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003901
• Start: 5450730
• End: 5453137
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_5453138..5453589
• Length (nt): 452
• Chromosome Location: III: 5453138-5453589
• Organism: Caenorhabditis elegans

100 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes with significantly increased expression in eat-2(ad465) treated with 2% DMSO for 72 hours, comparing to in N2 treated with 2% DMSO for 72 hours.	Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes.	WBPaper00048989:eat-2(ad465)_upregulated_in-DMSO
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_E
	Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector.	Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples.	WBPaper00051039:germline_enriched
Bacteria infection: Xenorhabdus nematophila	Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila.	Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets.	WBPaper00041606:CE_X.nematophila_regulated
	Proteins differently expressed in old Day 10 atm-1 (gk186) worms compared to all other conditions.	N.A.	WBPaper00051555:atm-1(gk186)_regulated_protein
	Genes that showed significant differential expressed between control and 150 mg\/L Atrazine treatment.	t-test, p < 0.05.	WBPaper00036123:Atrazine_regulated
	Proteins that were insoluble in a strong-detergent buffer. The insoluble proteins were solublized with formic acid and digested with typsin, followed by LC-MS-MS.	N.A.	WBPaper00037047:insoluble_protein

10 Expression Patterns

• Primary Identifier: Expr1031838
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6114
• Remark: Strain: BC10199
• Reporter Gene: [paa-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGCGCGGTAATCTTTTT] 3' and primer B 5' [CGACAACCGAGATGATGAAG] 3'.
• Pattern: Adult Expression: pharynx; intestine; body wall muscle; unidentified cells; Larval Expression: pharynx; intestine; unidentified cells

• Primary Identifier: Expr6115
• Remark: Also expressed in (comments from author) : No comments. Strain: BC10200
• Reporter Gene: [paa-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGCGCGGTAATCTTTTT] 3' and primer B 5' [CGACAACCGAGATGATGAAG] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr1151586
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr14272
• Pattern: Transcripts of R155.3, paa-1, W01B6.6 and upp-1 can be detected by RT-PCR in micro-dissected gonadal tissues, suggesting they are expressed in the germline.

• Primary Identifier: Expr1020049
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr10619
• Subcellular Localization: Immunofluorescence of single-cell embryos revealed that PAA-1 located to centrosomes, mitotic spindles, P-granules and the nuclear envelope (data not shown).

• Primary Identifier: Expr2032906
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr15730
• Subcellular Localization: PAA-1 and SUR-6 localize to I-bands, and RSA-1 localizes to both I-bands and M-lines.

• Primary Identifier: Expr2014673
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

21 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003901
• Start: 5450730
• End: 5453137
• Strand: 1

21 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2408

1 Sequence Ontology Term