WormMine: Gene WBGene00004888

• WormBase Gene ID: WBGene00004888
• Gene Name: smo-1
• Sequence Name: K12C11.2
• Brief Description: smo-1 encodes the C. elegans ortholog of SUMO, a small ubiquitin-like moiety that, when attached to protein substrates, regulates their subcellular localization and activity; smo-1 is an essential gene: loss of its activity results in embryonic and larval lethality; in addition, smo-1 mutants have defects in synaptonemal complex disassembly and bivalent formation, enhance meiotic defects of zhp-3::gfp mutants and show mislocalization of ZHP-3 in late pachytene; smo-1 is also required for reproductive system development, where its target may be the LIN-11 LIM homeodomain protein.
• Organism: Caenorhabditis elegans
• Automated Description: Enables identical protein binding activity. Involved in several processes, including chromosome organization; multicellular organismal locomotion; and muscle cell cellular homeostasis. Predicted to be located in PML body. Expressed in several structures, including P3.p hermaphrodite; P4.p hermaphrodite; P8.p hermaphrodite; hermaphrodite somatic gonadal cell; and ventral nerve cord. Human ortholog(s) of this gene implicated in orofacial cleft 10. Is an ortholog of human SUMO1P1 (SUMO1 pseudogene 1).
• Biotype: SO:0001217
• Genetic Position: I :-14.6998 ±0.008159
• Length (nt): 588

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004888

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K12C11.2.1	K12C11.2.1	482	I: 1340678-1341265

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K12C11.2	K12C11.2	276	I: 1340703-1340768

91 RNAi Result

• WBRNAi00082812
• WBRNAi00034310
• WBRNAi00025954
• WBRNAi00066959
• WBRNAi00067110
• WBRNAi00067146
• WBRNAi00067150
• WBRNAi00067190
• WBRNAi00067775
• WBRNAi00050648
• WBRNAi00000082
• WBRNAi00061300
• WBRNAi00099938
• WBRNAi00100450
• WBRNAi00094180
• WBRNAi00111578
• WBRNAi00108414
• WBRNAi00061301
• WBRNAi00061302
• WBRNAi00061303
• WBRNAi00061304
• WBRNAi00061305
• WBRNAi00069927
• WBRNAi00069943
• WBRNAi00069951
• WBRNAi00069956
• WBRNAi00069967
• WBRNAi00069973
• WBRNAi00069976
• WBRNAi00070017

11 Allele

• gk963902
• gk963630
• gk963701
• gk102906
• gk702291
• WBVar01555591
• gk630875
• gk938986
• ok359
• gk938987
• zh140

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004888
• Start: 1340678
• End: 1341265
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_1341266..1341271
• Length (nt): 6
• Chromosome Location: I: 1341266-1341271
• Organism: Caenorhabditis elegans

164 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts enriched in ASG according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:ASG_enriched
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage.	DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed.	WBPaper00048971:daf-16(mgDf50)_downregulated_L1
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C.	Transcripts that showed significantly increased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00058948:PA14_upregulated
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
Bacteria infection: Streptococcus gordonii	Transcripts that showed significantly decreased expression after L4 larva animals were exposed to wild type S. gordonii for 2-3 hours, comparing to animals exposed to S. gordonii delta-spxB.	Fold change > 2, FDR corrected p-value < 0.05.	WBPaper00055049:S.gordonii_downregulated
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
	Proteins interacting with HA-PPM-1.D.	N.A.	WBPaper00062498:PPM-1.D_interacting
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral

10 Expression Patterns

• Primary Identifier: Expr2034154
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6394
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15527
• Reporter Gene: [smo-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGAGACCTGACGATACCGC] 3' and primer B 5' [CGGCGATCGTTTATAGCG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; developing vulva; developing spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; tail neurons

• Primary Identifier: Expr1032427
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr13766
• Subcellular Localization: SMO-1 localized to germline nuclei throughout prophase I.

• Primary Identifier: Expr3449
• Pattern: At the L4 stage, SMO-1::GFP marker was expressed in each of the 64 uterine cells, the somatic spermathecal cells, the sheath cells that cover the gonadal arms, the hypodermis, and seam cells. The two DTCs of the somatic gonad also expressed the transgene. At the early L3 stage, expression was detected in the six vulval precurcor cells (VPCs), and at the L4 stage SMO-1::GFP was found in all 22 vulval nuclei, as well as in the gonadal anchor cell (AC). The lack of germ cell expression could be attributed to germ-line silencing. Expression in embryos was detected as early as the gastrulation stage.

• Primary Identifier: Expr1020726
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram603
• Remark: Original chronogram file: chronogram.1632.xml
• Reporter Gene: [K12C11.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1154360
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2015921
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr13970
• Subcellular Localization: SMO-1 localizes to the chromatin of germline nuclei and then to the axes of the bivalent short arms in late diakinesis stage oocytes.

55 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004888
• Start: 1340678
• End: 1341265
• Strand: 1

55 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	SUMO-conjugated worm proteins identified by affinity chromatography and mass spectrometry	N.A.	WBPaper00061478:SUMO-conjugated_protein
	Proteins that were modified by SUMO (smo-1). Using the strain RU86[smo-1(ok359); Is(psmo-1::smo-1gfp::3'UTRsmo-1] expressing HIS-GFP tagged SUMO, authors set up the purification of proteins modified by SUMO using immobilized metal ion affinity chromatography (IMAC).	Proteins were considered as SUMOylated if they were identified in at least 3 independent experiments, each protein identified with at least two peptides, FDR below 1% and not present in any of the control purifications from wild-type N2 worms or present with raw intensity greater than 10 times than in control purifications.	WBPaper00053615:SMO-1_target

1 Sequence

• Length: 588

1 Sequence Ontology Term