WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005046 Gene Name  sra-20
Sequence Name  ? F28C12.4 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway and sensory perception of chemical stimulus. Predicted to be located in membrane. Biotype  SO:0001217
Genetic Position  I :13.9421 ±0.001215 Length (nt)  ? 1657
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005046

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F28C12.4.1 F28C12.4.1 1020   I: 12696558-12698214
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F28C12.4 F28C12.4 1020   I: 12696558-12696812

2 RNAi Result

WormBase ID
WBRNAi00045807
WBRNAi00003513

65 Allele

Public Name
gk963849
gk964175
gk963095
WBVar01433965
WBVar01433966
WBVar01714443
gk963508
gk963509
gk125520
gk125519
gk125516
gk125515
gk125518
WBVar00159500
gk125517
WBVar02056710
WBVar02056709
WBVar01850196
WBVar01850195
WBVar01850194
WBVar01850193
WBVar01850200
WBVar01850199
WBVar01850198
WBVar01850197
WBVar01850188
WBVar01850187
WBVar01850186
WBVar01850185
WBVar01850192

1 Chromosome

WormBase ID Organism Length (nt)
I Caenorhabditis elegans 15072434  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005046 12696558 12698214 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_12698215..12698903   689 I: 12698215-12698903 Caenorhabditis elegans

23 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_18
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Genes significantely Up-regulated by GRO-seq in csr-1 hypomorph vs. N2 using DESeq p < 0.05. DESeq package with an FDR of < 0.05. WBPaper00045050:csr-1(hypomorph)_upregulated
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Germline-enriched and sex-biased expression profile cluster C. hierarchical clustering [cgc6390]:Cluster_C
  Genes that showed significant differential expressed between control and 150 mg\/L Atrazine treatment. t-test, p < 0.05. WBPaper00036123:Atrazine_regulated
  Genes found to be regulated in daf-16(mgDf50) by resveratrol treatment with p < 0.01. N.A. WBPaper00026929:Resveratrol_regulated_daf-16
Bacteria infection: Photorhabdus luminescens Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:P.lumniescens_24hr_upregulated_TilingArray
Temperature Shift: 25C vs 15C for 16 hours at L4 larva stage. Transcripts that showed significantly increased expression in AFD neurons comparing to in whole animals. DESeq2, fold change > 2, FDR < 0.05. WBPaper00065158:AFD_enriched
Bacteria infection: Enterococcus faecalis Genes down-regulated in animals infected with Enterococcus faecalis compared to the E. coli OP50 control after 24h of infection. MAANOVA and BRB-Array-Tools. WBPaper00030985:Enterococcus_faecalis_downregulated
  Transcripts that showed significantly decreased expression in drh-3(rrr2) comparing to in N2. edgeR, log2 fold change > 2 or < -2. WBPaper00053888:drh-3(rrr2)_downregulated
  Transcripts that showed significantly increased expression in sensory neuron (labeled by iaIs25[Pgcy-37::GFP + unc-119(+)]) comparing to in whole worm. Fold change > 2, p-value < 0.05. WBPaper00060661:sensory-neuron_enriched
  Genes that showed significantly increased expression after exposure to adsorbable organic bromine compounds (AOBr) contained in M. aeruginosa batch culture. Differentially expressed genes (DEGs) were identified with a random variance t-test and a significance analysis of microarrays (SAM) test. Genes were considered statistically significant if their p-value was less than 0.05, the false discovery rate less than 0.3, and the fold change compared to control at least <= 0.67 or >=1.5. WBPaper00046853:AOBr_M.aeruginosa-batch-culture_upregulated
  Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-42-srw-113
  Genes with differential expression under 0.5mg/l Chlorpyrifos (CPF) treatment at 24 centigrade. To identify the differentially expressed genes in each treatment authors used linear models per toxicant and temperature (gene expression = Toxicant (effect) + error). The lm function in R stats package was used to implement the linear models analysis with recommended default options. For threshold determination authors used a permutation approach. For each of the 23,232 permutations used authors randomly picked a transcript (array spot), which could only be picked once. Authors combined all the expression values of this transcript and randomly distributed them over the replicates and used them in the linear model. In this way authors obtained a threshold for each of the toxicants. Authors used a -log10 p-value 2 as common threshold for the analysis, which resembles to the following FDR per toxicant: 0.0155 for CPF at 24 centigrade, 0.0148 for DZN at 24 centigrade, 0.0168 for CPF+DZN at 24 centigrade, 0.0142 for CPF at 16 centigrade, 0.0151 for DZN at 16 centigrade, and 0.0148 for CPF+DZN, at 16 centigrade. WBPaper00040210:Chlorpyrifos_24C_regulated
  Genes that showed significant differential expressed between control and 1000 mg\/L Fluoranthene treatment. t-test, p < 0.05. WBPaper00036123:Fluoranthene_regulated
  Single-cell RNA-Seq cell group 77_0 expressed in neuron. scVI 0.6.0 WBPaper00065841:77_0

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034370 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Strain: BC13709 [sra-20::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCAATGTCAGAGAAAGTGTTCCA] 3' and primer B 5' [GGCGGTTTTGTTGATGTTTT] 3'. Expr5895 Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons;  
Strain: BC14527 [sra-20::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCAATGTCAGAGAAAGTGTTCCA] 3' and primer B 5' [GGCGGTTTTGTTGATGTTTT] 3'. Expr5896 Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons;  
    Expr2016135 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1014492 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.784.xml [F28C12.4:gfp] transcriptional fusion. Chronogram1866    
    Expr1149718 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

6 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005046 12696558 12698214 1

6 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables

0 Regulates Expr Cluster

1 Sequence

Length
1657

1 Sequence Ontology Term