WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005163 Gene Name  srg-5
Sequence Name  ? T12A2.11 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable transmembrane signaling receptor activity. Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Expressed in head neurons and ray. Biotype  SO:0001217
Genetic Position  III :-1.40693 ±8.3e-05 Length (nt)  ? 2225
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005163

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T12A2.11.1 T12A2.11.1 1541   III: 6262323-6264547
Transcript:T12A2.11.2 T12A2.11.2 1269   III: 6262323-6263973
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T12A2.11 T12A2.11 972   III: 6262509-6262718

7 RNAi Result

WormBase ID
WBRNAi00053145
WBRNAi00053146
WBRNAi00053151
WBRNAi00018614
WBRNAi00018616
WBRNAi00005328
WBRNAi00035489

23 Allele

Public Name
gk964518
gk176272
gk963814
gk876058
gk616647
gk378729
WBVar00057085
gk398680
gk782342
WBVar01645013
gk765758
WBVar01645014
gk838724
WBVar02018875
WBVar02018876
WBVar01785730
otn8549
gk621336
WBVar01566625
gk560043
gk417150
gk677940
gk742804

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005163 6262323 6264547 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

40 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_aging
Reduced humidity (98% relative humidity). Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis. Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001. WBPaper00044578:reduced-humidity_downregulated_microarray
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts that showed significantly increased expression in sams-3(RNAi) comparing to N2 animals injected with empty vector. Deseq FDR < 0.01, fold change > 2. WBPaper00065005:sams-3(RNAi)_upregulated
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h). Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the -1h timepoint. Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_EtBr-exposed_48h
UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed under UVC exposure and EtBr treatment vs under EtBr treatment but without UVC exposure at the -3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:UVC-EtBr-exposed_vs_EtBr-exposed_51h
  Genes with expression 1.5X depleted in PVD and OLL neurons. Data sets were normalized by RMA and transcripts showing relative PVD enrichment (>=1.5X) vs. the reference sample were identified by SAM analysis (False Discovery Rate, FDR < 1%) WBPaper00036375:depleted_in_PVD_OLL
  Genes with differential expression under 1.0mg/l Diazinon treatment at 16 centigrade. To identify the differentially expressed genes in each treatment authors used linear models per toxicant and temperature (gene expression = Toxicant (effect) + error). The lm function in R stats package was used to implement the linear models analysis with recommended default options. For threshold determination authors used a permutation approach. For each of the 23,232 permutations used authors randomly picked a transcript (array spot), which could only be picked once. Authors combined all the expression values of this transcript and randomly distributed them over the replicates and used them in the linear model. In this way authors obtained a threshold for each of the toxicants. Authors used a -log10 p-value 2 as common threshold for the analysis, which resembles to the following FDR per toxicant: 0.0155 for CPF at 24 centigrade, 0.0148 for DZN at 24 centigrade, 0.0168 for CPF+DZN at 24 centigrade, 0.0142 for CPF at 16 centigrade, 0.0151 for DZN at 16 centigrade, and 0.0148 for CPF+DZN, at 16 centigrade. WBPaper00037113:Diazinon_16C_regulated
  Genes with expression level regulated by genotype (N2 vs CB4856) at Old adults stage (214 hours at 24 centigrade). Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0136. WBPaper00040858:eQTL_regulated_old
  Genes from eat-2(ad465) animals with significantly increased expression after 72 hours of treatment on growth media with 10uM rapamycin in 2% DMSO. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:eat-2(ad465)_rapamycin_upregulated
  Genes up-regulated after 24 hour exposure to colistin. Gene lists were created using a cutoff P-value of < 0.05, 2-fold change. WBPaper00045673:colistin_upregulated
  Genes that showed significantly increased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control. Fold change > 1.2 or < 0.8. WBPaper00042477:rsr-2(RNAi)_upregulated_TilingArray
  Top 300 transcripts enriched in anterior arcade cell according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:Anterior_arcade_cell
  Genes that showed increased expression in xpa-1(ok698) comparing with N2 in mixed stages. After pre-processing and normalization, the Student t-test was executed to reveal transcripts statistically significantly regulated at the 95% confidence level (P < 0.05) between xpa-1 and WT. WBPaper00042234:xpa-1_upregulated
  Transcripts that showed significantly increased expression in nfki-1(cer1) animals at L4 larva stage, comparing to in N2 animals. Differentially expressed genes between wild type and knockouts were explored using DESeq2 R package (v.1.20.0) considering a threshold of adjusted p value < 0.01. WBPaper00060445:nfki-1(cer1)_upregulated_L4
  Genes that showed decreased expression in polyQ-expanded hungtingtin (HTT) 128Q touch receptor cells comparing to in 19Q touch receptor cells. Authors performed the statistial analysis of the microarray data using the Varmixt tool of the R package, with VM parameters and FDR corrections of P-Values. WBPaper00045417:128Q-huntingtin_downreglated
  Transcripts that showed significantly increased expression in drh-3(rrr2) comparing to in N2. edgeR, log2 fold change > 2 or < -2. WBPaper00053888:drh-3(rrr2)_upregulated
  Top 300 transcripts enriched in arcade cell according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:Arcade_cell_anterior_and_posterior
  Genes down regulated in nhr-114(RNAi) comparing to glp-1(q224ts). Differentially expressed genes had a fold change cutoff of 2.0 and an unpaired t test p value cutoff of 0.05 for WT+Trp versus WT and 0.01 for nhr-114 versus glp-1. WBPaper00042194:nhr-114(RNAi)_downregulated
  Genes predicted to be upregulated more than 2.0 fold in rrf-2(ok210) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rrf-2(ok210)_upregulated
  Transcripts that showed significantly decreased expression in adr-1(tm668) comparing to in N2. DESeq2, p-value < 0.05 and a fold enrichment log2fold > 0.5. WBPaper00055226:adr-1(tm668)_downregulated
  Transcripts that showed significantly decreased expression in tdc-1(n3419);odIs77 comparing to in odIs77 control animals. EdgeR, FDR<0.01 WBPaper00060921:tdc-1(n3419)_downregulated

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034573 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12021 [srg-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGGTATTTCTGACAGAGACTCA] 3' and primer B 5' [TTCAAATTCTCAGGCAAAGGA] 3'. Expr6678 Adult Expression: Nervous System; labial sensilla; Larval Expression: Nervous System; labial sensilla;  
    Expr14048 IL2, OLQ (dimmer), MALE: CEMs and Ray neurons  
    Expr1020559 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.1615.xml [T12A2.11:gfp] transcriptional fusion. Chronogram586    
    Expr2016348 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1156747 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

5 GO Annotation

Annotation Extension Qualifier
  enables
  located_in
  located_in
  located_in
  involved_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005163 6262323 6264547 -1

5 Ontology Annotations

Annotation Extension Qualifier
  enables
  located_in
  located_in
  located_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
2225

1 Sequence Ontology Term