WormMine: Gene WBGene00006649

• WormBase Gene ID: WBGene00006649
• Gene Name: tth-1
• Sequence Name: F08F1.8
• Brief Description: tth-1 encodes a thymosin beta ortholog that contains four functionally distinct thymosin beta repeats; in vitro, TTH-1 binds multiple actin monomers as well as filamentous actin suggesting that, as its homology predicts, TTH-1 plays a direct role in regulating actin polymerization and cytoskeletal organization in C. elegans; consistent with this, loss of tth-1 activity via a deletion mutation that removes upstream sequences results in animals with a dumpy morphology that are sterile as a result of maternal effect lethality associated with deformed oocytes containing abnormally distributed actin; tth-1 mRNA is present throughout development, while TTH-1 protein is detected in the adult gonad in the inside edges of the membranous structures surrounding germline nuclei, the cytoplasm and cortex of oocytes, early embryos at points of cell contact, the developing nerve ring, and then throughout the larval and adult body, with specific enrichment in the intestine and spermatheca.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable actin monomer binding activity. Predicted to be involved in actin filament organization. Predicted to be located in cytosol. Expressed in distal tip cell; nerve ring; oocyte; spermatheca; and terminal bulb.
• Biotype: SO:0001217
• Genetic Position: X :-0.047642 ±0.01533
• Length (nt): 1254

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006649

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F08F1.8.1	F08F1.8.1	731	X: 8422480-8423731
Transcript:F08F1.8.2	F08F1.8.2	533	X: 8422813-8423733

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F08F1.8	F08F1.8	456	X: 8422866-8422997

3 RNAi Result

• WBRNAi00044013
• WBRNAi00012902
• WBRNAi00033485

26 Allele

• gk964260
• gk962707
• gk964193
• gk964194
• gk963896
• gk963732
• gk964126
• gk964401
• gk964402
• tm11178
• tm10711
• gk43
• WBVar02046622
• WBVar01470124
• WBVar01470125
• gk423351
• WBVar01470123
• gk378424
• gk339049
• gk806817
• gk409144
• gk287400
• gk287399
• gk287398
• gk876437
• WBVar01885311

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006649
• Start: 8422480
• End: 8423733
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_8422056..8422479
• Length (nt): 424
• Chromosome Location: X: 8422056-8422479
• Organism: Caenorhabditis elegans

265 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly decreased expression in morc-1(tm6048) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_morc-1(tm6048)_downregulated
	Transcripts enriched in AMso according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:AMso_enriched
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts enriched in PHso according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:PHso_enriched
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
Starvation	Starvation-induced transcripts that showed significantly increased expression in post dauer animals comparing to wild type control.	edgeR	WBPaper00053713:Starvation-induced_postdauer_vs_control_upregulated
	Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:sek-1(km4)_downregulated_cisplatin
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after N2 animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_N2
	Transcripts that showed significantly increased expression in ngn-1(ok2200) embryos comparing to in N2.	DESeq2 ver.3.4.1	WBPaper00059537:ngn-1(ok2200)_upregulated

8 Expression Patterns

• Primary Identifier: Expr2035703
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5681
• Remark: Authors indicate the expression pattern was for tag-123, but actual primer shows that the experiment is for tth-1. --wjc Strain: BC10520
• Reporter Gene: [F08F1.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACATGTTCACCCAGAAAA] 3' and primer B 5' [GCGAGTTTTGGAGGAAAGTG] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons

• Primary Identifier: Expr12265
• Pattern: The localization of tetraThymosin-beta is shown in oocytes (in dissected gonads of adult worms), in embryos and in whole adult organisms. TetraThymosin-beta was maternally expressed and in the adult gonad diffusely present in the cytoplasm of the oocytes, with strong staining at the cell cortex where also actin is present. In the distal arm of the gonad, tetraThymosin-beta localized to the inside edges of the membrane cubicles surrounding germ cell nuclei. Here, tetraThymosin-beta did not localize to the lateral side of the membrane cubicles where actin is arranged in a 'honeycomb' structure (Strome, 1986). In two-cell stage embryos, tetraThymosin-beta was enriched in the cell-cell contact where actin was also concentrated. The tetraThymosin-beta signal was clearly apparent until the four-cell stage and became weaker later on. At the comma stage (290 min after the first cell division), tetraThymosin-beta staining was observed at the developing nerve ring that is the largest axonal bundle in the nematode body and that positions around the isthmus of the pharynx. TetraThymosin-beta was evident in this region even before a clear actin signal was apparent. In larvae and adults, immunofluorescence yielded a diffuse but specific staining of the entire worm body with enrichment at the intestinal tract and spermatheca. At these stages, in contrast to what is observed in developing embryo, no prominent signal was observed in the head region where the nerve ring is located. In young adults is expressed in theposterior bulb of the pharynx. These immunostaining patterns were reproducible in three or more experiments and in 20 or more worms or embryos.

• Primary Identifier: Expr1032763
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr12264
• Pattern: A Northern Blot of different developmental stages shows that tetraThymosin mRNA is present throughout the worm's lifespan.

• Primary Identifier: Expr2017564
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1016059
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1147980
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

11 GO Annotation

1 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006649
• Start: 8422480
• End: 8423733
• Strand: -1

11 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1254

1 Sequence Ontology Term