WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00008546 Gene Name  gfat-1
Sequence Name  ? F07A11.2 Brief Description  gfat-1 encodes two isoforms of glucosamine--fructose-6-phosphate aminotransferase (EC:2.6.1.16, also known as glutamine-fructose-6-phosphate transaminase), paralogous to GFAT-2; GFAT-1 is predicted to catalyze the first, and rate-limiting, step of the hexosamine pathway in which glucosamine-6-phosphate is synthesized from L-glutamine and fructose-6-phosphate and ultimately converted to UDP-N-acetylglucosamine (UDP-GlcNAc); gfat-1 gain-of-function mutations result in resistance to endoplasmic reticulum stress and increased longevity as a result of increased UDP-Hex-NAc levels accompanied by increased activity of protein quality control mechanisms such as ER-associated protein degradation (ERAD), proteasomal activity, and autophagy; gfat-1 is expressed in many larval and adult tissues, most prominently in epidermal seam cells and the pharynx, and gfat-1 transcripts are somewhat enriched during oogenesis; gfat-1(RNAi) animals have an osmotically-sensitive embryonic lethal phenotype, presumably because of defects in chitin and eggshell synthesis.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable glutamine-fructose-6-phosphate transaminase (isomerizing) activity. Involved in IRE1-mediated unfolded protein response. Expressed in tail. Used to study Machado-Joseph disease. Human ortholog(s) of this gene implicated in congenital myasthenic syndrome 12; obesity; and type 2 diabetes mellitus. Is an ortholog of human GFPT1 (glutamine--fructose-6-phosphate transaminase 1).
Biotype  SO:0001217 Genetic Position  II :3.78428±
Length (nt)  ? 3027
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00008546

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F07A11.2b.1 F07A11.2b.1 2335   II: 11592392-11595418
Transcript:F07A11.2a.1 F07A11.2a.1 2364   II: 11592393-11595409
Transcript:F07A11.2a.2 F07A11.2a.2 2270   II: 11592460-11595410
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F07A11.2a F07A11.2a 2178   II: 11592552-11592596
CDS:F07A11.2b F07A11.2b 2139   II: 11592552-11592596

8 RNAi Result

WormBase ID
WBRNAi00085584
WBRNAi00030589
WBRNAi00008075
WBRNAi00022653
WBRNAi00025011
WBRNAi00043841
WBRNAi00008604
WBRNAi00094861

46 Allele

Public Name
gk963801
gk963053
gk962684
gk963539
WBVar01935702
gk693569
WBVar01851450
gk830093
gk875133
gk476039
WBVar00553177
gk631629
gk525123
gk689164
gk606990
gk822716
gk395132
gk656614
gk854798
gk650274
gk797523
gk588743
gk553805
WBVar01245057
ttTi31249
gk480408
gk391936
WBVar01666635
gk677608
WBVar01666638

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00008546 11592392 11595418 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_11592124..11592391   268 II: 11592124-11592391 Caenorhabditis elegans

208 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_N2
  Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq. DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison. WBPaper00045934:wrn-1(gk99)_upregulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Escherichia coli HB101. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). CuffDiff2 WBPaper00051265:F4_hrde-1(tm1200)_upregulated
  Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage. DEseq2, fold change > 2 WBPaper00064505:tamoxifen_upregulated
  Transcripts that showed significantly increased expression in nhr-114(gk849) comparing to wild type animals at L4 larva. DESeq2 1.26.0, fold change > 2, FDR < 0.05. WBPaper00064539:nhr-114(gk849)_upregulated
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
Heat Shock: 35C 4 hours at L4 larva stage. Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours DESeq2 WBPaper00057154:HeatShock_downregulated_mRNA
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : No comments. Strain: BC15543 [F07A11.2a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAATTTTTCTGATTTCTGTGGG] 3' and primer B 5' [AATTCCGCAGATTTTGGATG] 3'. Expr5667 Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; vulval muscle; body wall muscle; head mesodermal cell; seam cells; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; body wall muscle; head mesodermal cell; seam cells; Nervous System; head neurons; unidentified cells in tail ;  
    Expr1019553 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr11670 gfat-1::cfp was expressed most prominently in epidermal seam cells and the pharynx.  
    Expr1033724 Tiling arrays expression graphs  
    Expr2012025 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2030261 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1147818 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
Original chronogram file: chronogram.2127.xml [F07A11.2:gfp] transcriptional fusion. Chronogram1061    

15 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables

12 Homologues

Type
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00008546 11592392 11595418 -1

15 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
3027

1 Sequence Ontology Term