WormMine: Gene WBGene00008857

• WormBase Gene ID: WBGene00008857
• Gene Name: timm-23
• Sequence Name: F15D3.7
• Brief Description: timm-23 encodes the C. elegans ortholog of the mitochondrial import inner membrane translocase subunit Tim23; by homology, timm-23 is predicted to function in transporting proteins across the mitochondrial inner membrane.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable mitochondrion targeting sequence binding activity and protein transmembrane transporter activity. Involved in protein import into mitochondrial matrix. Predicted to be located in mitochondrial inner membrane. Predicted to be part of TIM23 mitochondrial import inner membrane translocase complex. Is an ortholog of human TIMM23 (translocase of inner mitochondrial membrane 23).
• Biotype: SO:0001217
• Genetic Position: I :9.25443±
• Length (nt): 972

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00008857

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F15D3.7.1	F15D3.7.1	865	I: 11578641-11579612

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F15D3.7	F15D3.7	729	I: 11578645-11578770

16 RNAi Result

• WBRNAi00095570
• WBRNAi00031002
• WBRNAi00093677
• WBRNAi00093686
• WBRNAi00093680
• WBRNAi00044712
• WBRNAi00085650
• WBRNAi00096332
• WBRNAi00096415
• WBRNAi00096498
• WBRNAi00096581
• WBRNAi00109999
• WBRNAi00109148
• WBRNAi00109918
• WBRNAi00109951
• WBRNAi00109984

35 Allele

• gk962858
• gk962706
• gk963849
• gk433891
• gk500117
• gk427378
• gk521511
• gk881696
• gk411976
• gk780746
• gk667499
• gk645175
• gk656073
• gk616012
• gk963906
• WBVar01433194
• WBVar01433195
• WBVar01433196
• WBVar01713243
• WBVar01713244
• tm5921
• WBVar00157385
• gk940466
• WBVar00157384
• gk123034
• WBVar01663557
• WBVar00539562
• gk123036
• gk123035
• gk123037

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00008857
• Start: 11578641
• End: 11579612
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_11579613..11579705
• Length (nt): 93
• Chromosome Location: I: 11579613-11579705
• Organism: Caenorhabditis elegans

128 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:oocyte_vs_mitosis_upregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
	Transcripts that showed significantly increased expression in clk-1(qm30) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:clk-1(qm30)_upregulated
	Transcripts that showed significantly increased expression in isp-1(qm150) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:isp-1(qm150)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after hlh-30(tm1978) animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_hlh-30(tm1978)
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
Fungi infection: Haptoglossa zoospora.	Transcripts that showed significantly altered expression after L4 N2 animals were exposed to omycete Haptoglossa zoospora for 6 hours.	Kalisto abundance files were converted and analysed using Sleuth in a R pipeline. Standard Sleuth protocols were used to calculate differential expression. P value < 0.01 and FDR < 0.01.	WBPaper00062354:H.zoospora_6h_regulated
	Transcripts that showed significantly increased expression in lin-40(yth27);cco-1(RNAi) animals comparing to lin-40(yth27) animals injected with empty vector.	N.A.	WBPaper00060084:cco-1(RNAi)_upregulated_lin-40(yth27)

6 Expression Patterns

• Primary Identifier: Expr2035542
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5769
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14221
• Reporter Gene: [F15D3.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCAGAGAAGCCGGTGAG] 3' and primer B 5' [TTTTCCTGGAAGTTTGCAATTTA] 3'.
• Pattern: Adult Expression: pharynx; Larval Expression: pharynx

• Primary Identifier: Expr1033860
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1022329
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017403
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1148685
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

12 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00008857
• Start: 11578641
• End: 11579612
• Strand: 1

12 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 972

1 Sequence Ontology Term