WormMine: Gene WBGene00009978

• WormBase Gene ID: WBGene00009978
• Gene Name: F53E4.1
• Sequence Name: F53E4.1
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable chromatin binding activity. Predicted to be located in cytoplasm. Expressed in tail. Is an ortholog of human KLHDC3 (kelch domain containing 3).
• Biotype: SO:0001217
• Genetic Position: :±
• Length (nt): 15871

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00009978

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F53E4.1b.1	F53E4.1b.1	1637	V: 15652430-15659079
Transcript:F53E4.1a.1	F53E4.1a.1	1641	V: 15652432-15659067
Transcript:F53E4.1c.1	F53E4.1c.1	567	V: 15652786-15654451
Transcript:F53E4.1d.1	F53E4.1d.1	1299	V: 15652786-15668300

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F53E4.1b	F53E4.1b	1263	V: 15652786-15652967
CDS:F53E4.1a	F53E4.1a	1281	V: 15652786-15652967
CDS:F53E4.1c	F53E4.1c	567	V: 15652786-15652967
CDS:F53E4.1d	F53E4.1d	1299	V: 15652786-15652967

4 RNAi Result

• WBRNAi00001071
• WBRNAi00048127
• WBRNAi00032694
• WBRNAi00015511

484 Allele

• gk963271
• gk963301
• gk964458
• gk964459
• gk964389
• gk963695
• WBVar02062501
• WBVar02062500
• WBVar02062503
• WBVar02062502
• WBVar02062505
• WBVar02062504
• WBVar02062506
• WBVar02062499
• WBVar02062498
• WBVar02067975
• WBVar01975838
• WBVar01975839
• WBVar01975836
• WBVar01975837
• WBVar01975835
• WBVar01975841
• WBVar01975842
• WBVar01975840
• WBVar01975849
• WBVar01975847
• WBVar01975848
• WBVar01975845
• WBVar01975846
• WBVar01975843

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00009978
• Start: 15652430
• End: 15668300
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_15652414..15652429
• Length (nt): 16
• Chromosome Location: V: 15652414-15652429
• Organism: Caenorhabditis elegans

127 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly decreased expression in mdt-15(mg584gf) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:mdt-15(mg584)_downregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly increased expression in nhr-114(gk849) comparing to wild type animals at L4 larva.	DESeq2 1.26.0, fold change > 2, FDR < 0.05.	WBPaper00064539:nhr-114(gk849)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly increased expression in animal with pgph-2 overepxreesion [pgph-2p-pgph-2; myo-2p-mcherry] in glucose excess condition.	Genes with anadjusted P-value <= 0.05 found by DESeq2 were assigned as differentially expressed.	WBPaper00065926:pgph-2(overepxreesion)_upregulated_glucose
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
Reduced humidity (98% relative humidity).	Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_downregulated_microarray
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_downregulated

7 Expression Patterns

• Primary Identifier: Expr6155
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14284
• Reporter Gene: [F53E4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAACCCGTGTAATTTTTGATGTT] 3' and primer B 5' [GTCCATGTGGCGATTTTTG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; intestine; Reproductive System; distal tip cell; vulva other; spermatheca; gonad sheath cells; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail ; Larval Expression: pharynx; arcade cells; intestine; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail

• Primary Identifier: Expr1151936
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2022286
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1021710
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1034349
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2004062
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1299
• Remark: Original chronogram file: chronogram.2418.xml
• Reporter Gene: [F53E4.1:gfp] transcriptional fusion.

2 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00009978
• Start: 15652430
• End: 15668300
• Strand: -1

2 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 15871

1 Sequence Ontology Term