WormMine: Gene WBGene00018474

• WormBase Gene ID: WBGene00018474
• Gene Name: cnep-1
• Sequence Name: F45E12.1
• Brief Description: cnep-1 encodes a putative serine/threonine phosphatase, orthologous to budding yeast Nem1p and human DULLARD; CNEP-1 is expressed in pharynx and intestine; CNEP-1 is distantly similar to FCP-1 and SCPL-1, -3, and -4; by homology, CNEP-1 is predicted to reside in the endoplasmic reticulum membrane in a complex with SPO-7 that functions to dephosphorylate the phosphatidic acid phosphatase LPIN-1 and thus regulate phospholipid metabolism; loss of cnep-1 activity via RNAi results in a twinned nuclei phenotype in which the embryonic blastomeres AB and P1 contain two nuclei; the twinned nuclei phenotype is also seen in embryos lacking spo-7 and lpin-1 activity.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable protein serine/threonine phosphatase activity. Involved in nuclear membrane reassembly and regulation of nuclear division. Located in nuclear envelope. Is an ortholog of human CTDNEP1 (CTD nuclear envelope phosphatase 1).
• Biotype: SO:0001217
• Genetic Position: II :0.501491 ±6.6e-05
• Length (nt): 3528

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00018474

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F45E12.1a.1	F45E12.1a.1	1397	II: 7310348-7313795
Transcript:F45E12.1b.1	F45E12.1b.1	831	II: 7310375-7313256
Transcript:F45E12.1a.2	F45E12.1a.2	1396	II: 7311480-7313875

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F45E12.1a	F45E12.1a	741	II: 7311516-7311602
CDS:F45E12.1b	F45E12.1b	831	II: 7310375-7310437

8 RNAi Result

• WBRNAi00047393
• WBRNAi00047396
• WBRNAi00047398
• WBRNAi00015019
• WBRNAi00022362
• WBRNAi00032298
• WBRNAi00061811
• WBRNAi00111105

43 Allele

• gk963801
• gk963053
• gk962682
• WBVar01375134
• gk320298
• gk875963
• gk477828
• gk471709
• gk447447
• gk617740
• gk484948
• gk791634
• gk414811
• gk584402
• gk393610
• gk342099
• gk669117
• gk725844
• gk422123
• gk747429
• gk445361
• WBVar01934924
• tm4369
• gk146708
• gk146709
• gk146707
• gk146705
• gk146706
• gk146703
• gk146704

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00018474
• Start: 7310348
• End: 7313875
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

72 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines.	RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1.	WBPaper00035269:cde-1_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
Fungi infection: Haptoglossa zoospora.	Transcripts that showed significantly altered expression after L4 N2 animals were exposed to omycete Haptoglossa zoospora for 6 hours.	Kalisto abundance files were converted and analysed using Sleuth in a R pipeline. Standard Sleuth protocols were used to calculate differential expression. P value < 0.01 and FDR < 0.01.	WBPaper00062354:H.zoospora_6h_regulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_E
	Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector.	Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples.	WBPaper00051039:germline_enriched
Bacteria infection: Xenorhabdus nematophila	Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila.	Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets.	WBPaper00041606:CE_X.nematophila_regulated
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h).	Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the -1h timepoint.	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:control_vs_EtBr-exposed_48h
	Top 300 transcripts enriched in g1AL, g1AR according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:g1A
	Proteins that showed differential expression in (B) let-7(mg279);[let-7 sponge] when comparing to (A) [let-7 sponge], and in (C) gld-1(op236); let-7(mg279);[let-7 sponge] when comparing to (A) [let-7 sponge]	N.A.	WBPaper00044501:gld-1_let-7_regulated
	Genes identified as down-regulated at a 5% false discovery rate through RNAseq experiments with three tatn-1(qd182) and three N2 RNA samples.	ANOVA with FDR <= 0.05.	WBPaper00044656:tatn-1(qd182)_downregulated
	Genes expressed in embryonic motor neurons (identified by unc-4::GFP expressing cells).	Genes called Present by MAS 5.0 in 2 out of 3 unc-4::GFP hybridizations.	WBPaper00025141:unc-4::GFP_Expressed_Genes

7 Expression Patterns

• Primary Identifier: Expr6077
• Remark: Strain: BC10267
• Reporter Gene: [F45E12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTTTCGTCCGATTTCGTG] 3' and primer B 5' [TGCGATTGTTGTGATGGTTC] 3'.
• Pattern: Adult Expression: pharynx; intestine; Larval Expression: pharynx; intestine

• Primary Identifier: Expr1151241
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2010271
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1037962
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2028513
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1027913
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr11677
• Subcellular Localization: CNEP-1::GFP is specifically enriched on the nuclear envelope.

21 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00018474
• Start: 7310348
• End: 7313875
• Strand: 1

21 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3528

1 Sequence Ontology Term