WormMine: Gene WBGene00019915

• WormBase Gene ID: WBGene00019915
• Gene Name: tbc-10
• Sequence Name: R06B10.5
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable GTPase activator activity. Is an ortholog of human TBC1D10A (TBC1 domain family member 10A) and TBC1D10C (TBC1 domain family member 10C).
• Biotype: SO:0001217
• Genetic Position: III :-24.8286 ±0.010554
• Length (nt): 5186

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00019915

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R06B10.5.1	R06B10.5.1	1498	III: 983261-988446

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R06B10.5	R06B10.5	1338	III: 983261-983416

2 RNAi Result

• WBRNAi00051371
• WBRNAi00006995

381 Allele

• gk963623
• gk962532
• gk964281
• WBVar02120666
• WBVar02124686
• WBVar01323215
• WBVar01323191
• WBVar01323190
• WBVar01323197
• WBVar01323198
• WBVar01323148
• WBVar01323147
• WBVar01323149
• WBVar01323150
• WBVar01323152
• WBVar01323155
• WBVar01323157
• WBVar01323156
• WBVar01323158
• WBVar01323160
• WBVar01323161
• WBVar01323167
• WBVar01323178
• WBVar02124779
• WBVar02121583
• WBVar02124401
• WBVar02123377
• WBVar02122933
• WBVar02121974
• WBVar02124343

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00019915
• Start: 983261
• End: 988446
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_988447..991880
• Length (nt): 3434
• Chromosome Location: III: 988447-991880
• Organism: Caenorhabditis elegans

67 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
20C vs 25C	Transcripts that showed differential expression in 20C vs 25C in mir-34(OverExpression) animals at adult stage.	N.A.	WBPaper00050488:20C_vs_25C_regulated_mir-34(OverExpression)_adult
	Transcripts unqiuely expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_enriched
	Transcripts that showed significantly increased expression in zip-3(gk3164) comparing to in N2, after exposed to P. aeruginosa for 18 hours.	p < 0.05	WBPaper00056326:zip-3(gk3164)_upregulated_P.aeruginosa-infected
	Transcripts that showed significantly increased expression in lin-22(ot269) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(ot269)_upregulated
20C vs 25C	Transcripts that showed differential expression in 20C vs 25C in N2 animals at adult stage.	N.A.	WBPaper00050488:20C_vs_25C_regulated_N2_adult
Bacteria infection: Xenorhabdus nematophila	Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila.	Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets.	WBPaper00041606:CE_X.nematophila_regulated
	Transcripts that showed significantly increased expression in alg-2(ok304), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-2(ok304)_upregulated
UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at just prior to the third UVC dose (48h).	Genes differentially expressed under EtBr treatment and UVC exposure vs under UVC exposure but without EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)).	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:UVC-EtBr-exposed_vs_UVC-exposed_48h
	Top 300 transcripts enriched in coelomocyte according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Coelomocyte
	Transcripts that showed significantly increased expression in lin-22(icb38) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(icb38)_upregulated
	Genes that showed significant differential expressed between control and 150 mg\/L Atrazine treatment.	t-test, p < 0.05.	WBPaper00036123:Atrazine_regulated
	Transcripts that showed significantly decreased expression in mitosis germline cells comparing to in meiosis germline cells.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:mitosis_vs_meiosis_downregulated

8 Expression Patterns

• Primary Identifier: Expr2035456
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6469
• Remark: Strain: BC10170
• Reporter Gene: [R06B10.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATTGGCTGAAAGGCGCGC] 3' and primer B 5' [TGGAAGAAAAACGGGGATAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; hypodermis; Nervous System; head neurons; neurons along body; tail neurons; unidentified cells; Larval Expression: pharynx; intestine; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr1038645
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1155059
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2017320
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr13865
• Subcellular Localization: TBC-10::GFP displays a transient enrichment pattern on extending pseudopods and nascent phagosomes.

• Primary Identifier: Expr1013068
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram2023
• Remark: Original chronogram file: chronogram.934.xml
• Reporter Gene: [R06B10.5:gfp] transcriptional fusion.

1 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00019915
• Start: 983261
• End: 988446
• Strand: 1

1 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5186

1 Sequence Ontology Term