WormMine: Gene WBGene00019983

• WormBase Gene ID: WBGene00019983
• Gene Name: sti-1
• Sequence Name: R09E12.3
• Brief Description: sti-1 encodes the C. elegans ortholog of the Sti1/Hop family of heat shock cochaperones; sti-1 plays a role in stress response, as sti-1 mutant animals have a shortened lifespan, decreased fertility at 20C, 25C, and 30C, and decreased thermotolerance; genetic interaction studies suggest that sti-1 may function together with daf-16 in regulating thermotolerance; STI-1 physically interacts with a number of proteins including HSP-1/Hsp70 and DAF-21/Hsp90, as well as proteins involved in translation and localized to the endoplasmic reticulum; a STI-1::GFP reporter is widely expressed in embryos as well as larvae and adults, with expression found in the pharynx, intestine, neurons, vulva, body wall muscles and male sensory rays; STI-1 appears to be a cytoplasmic protein.
• Organism: Caenorhabditis elegans
• Automated Description: Enables ATPase inhibitor activity; Hsp70 protein binding activity; and Hsp90 protein binding activity. Involved in determination of adult lifespan and response to heat. Located in cytoplasm. Expressed in several structures, including gonad; male-specific anatomical entity; pharyngeal muscle cell; touch receptor neurons; and vulva. Is an ortholog of human STIP1 (stress induced phosphoprotein 1).
• Biotype: SO:0001217
• Genetic Position: V :-19.953±
• Length (nt): 1258

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00019983

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R09E12.3.1	R09E12.3.1	1096	V: 773518-774775

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R09E12.3	R09E12.3	963	V: 773591-773602

13 RNAi Result

• WBRNAi00051630
• WBRNAi00106360
• WBRNAi00106396
• WBRNAi00106398
• WBRNAi00080963
• WBRNAi00080962
• WBRNAi00017654
• WBRNAi00080964
• WBRNAi00106403
• WBRNAi00106400
• WBRNAi00106283
• WBRNAi00114479
• WBRNAi00080965

38 Allele

• WBVar01584343
• gk963591
• gk963553
• gk964259
• gk963850
• gk963027
• gk963889
• gk962552
• gk962551
• WBVar01970639
• tm3744
• ttTi4199
• jh125
• WBVar01985228
• WBVar00580322
• gk617382
• ok3354
• gk753171
• gk756233
• gk525326
• gk926528
• WBVar00271362
• gk518278
• gk804805
• gk347866
• gk225249
• gk225250
• gk472785
• gk881488
• gk931073

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00019983
• Start: 773518
• End: 774775
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_774776..774994
• Length (nt): 219
• Chromosome Location: V: 774776-774994
• Organism: Caenorhabditis elegans

147 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977)
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Bacteria infection: Streptococcus gordonii	Transcripts that showed significantly decreased expression after L4 larva animals were exposed to wild type S. gordonii for 2-3 hours, comparing to animals exposed to S. gordonii delta-spxB.	Fold change > 2, FDR corrected p-value < 0.05.	WBPaper00055049:S.gordonii_downregulated
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
	Transcripts that showed significantly altered expression in rnp-6(dh1127) animals comparing to in N2 when fed with heat killed E. coli OP50.	Differentially expressed genes (DEGs) (q-value <0.05) between different samples were identified using the stringtie version 1.3.0, followed by Cufflinks version 2.2.	WBPaper00059824:rnp-6(dh1127)_regulated_OP50
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin_downregulated
Bacteria: B.thuringiensis	Transcripts in N2 animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_N2
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
Starvation	Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl)	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:starvation_regulated_LowSalt

12 Expression Patterns

• Primary Identifier: Expr2035111
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6490
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11304
• Reporter Gene: [R09E12.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGTAGATCACAACGATATGGG] 3' and primer B 5' [TACGGCGTCCGTCATTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Nervous System; head neurons; tail neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr8652
• Remark: Picture: Figure 2B.
• Pattern: Expression from this construct was detected in all major tissues at normal growth temperature. Particularly strong expression was observed in the intestine, the pharynx, the spermathecae and the body wall muscle cells.

• Primary Identifier: Expr8989
• Remark: Picture: Fig 3.
• Subcellular Localization: Immunostaining using anti-STI-1 antibody showed possible cytoplasmic localization of sti-1 in early-stage embryos.

• Primary Identifier: Expr8988
• Remark: Picture: Fig 3.
• Pattern: Analysis of the transformed animals revealed that sti-1 was ubiquitously expressed in the whole body of worms. Expression was predominantly observed in pharyngeal muscles, vulva epithelial cells, intestines, and striated body-wall muscles. GFP was also observed in tail regions of hermaphrodite and in sensory rays and spicules of male animals.

• Primary Identifier: Expr4025
• Remark: Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http://nematode.lab.nig.ac.jp).
• Pattern: Broadly expressed in gonad.

• Primary Identifier: Expr15095
• Pattern: HSP-90 and the cochaperones DAF-41, STI-1, and PPH-5 are expressed in most C. elegans cells (Gillan et al., 2009; Richie et al., 2011; Song et al., 2009), and we confirmed their expression in the TRNs.

• Primary Identifier: Expr1038677
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram989
• Remark: Original chronogram file: chronogram.2043.xml
• Reporter Gene: [R09E12.3:gfp] transcriptional fusion.

• Primary Identifier: Expr1155302
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1028543
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2016963
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

13 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00019983
• Start: 773518
• End: 774775
• Strand: 1

13 Ontology Annotations

1 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins coimmunoprecipitated with anti-CeSTI-1 antibody, according to proteomics analysis.	N.A.	WBPaper00033208:STI-1_interacting

1 Sequence

• Length: 1258

1 Sequence Ontology Term