WormMine: Gene WBGene00020140

• WormBase Gene ID: WBGene00020140
• Gene Name: ant-1.4
• Sequence Name: T01B11.4
• Brief Description: ant-1.4 encodes an ortholog of the human adenine nucleotide translocase ANT genes, the other ANT genes in C. elegans include ant-1.1, ant-1.2 and ant-1.3; phylogenetic analysis indicates that ant-1.4 is specific to C. elegans, resulting from a recent duplication following the speciation of the common ancestor of C. elegans, C. briggsae, and C. remanei; by homology, ANT-1.4 is predicted to mediate the exchange of ATP generated in the mitochondria for cytosolic ADP; ANT-1.4 GFP fusion protein is expressed in a pair of head neurons, amphid socket and sheath cells and in a few body-wall muscle and vulval muscle cells.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ATP:ADP antiporter activity. Predicted to be involved in negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway. Located in mitochondrion. Expressed in amphid sensillum; body wall musculature; rectal gland cell; somatic nervous system; and vulval muscle. Human ortholog(s) of this gene implicated in Alzheimer's disease; autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions 2; facioscapulohumeral muscular dystrophy; intrinsic cardiomyopathy (multiple); and mitochondrial DNA depletion syndrome (multiple). Is an ortholog of human SLC25A4 (solute carrier family 25 member 4); SLC25A5 (solute carrier family 25 member 5); and SLC25A6 (solute carrier family 25 member 6).
• Biotype: SO:0001217
• Genetic Position: IV :3.81996 ±0.003005
• Length (nt): 1131

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00020140

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T01B11.4.1	T01B11.4.1	1022	IV: 8459178-8460308

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T01B11.4	T01B11.4	942	IV: 8459227-8459596

6 RNAi Result

• WBRNAi00052073
• WBRNAi00017930
• WBRNAi00034996
• WBRNAi00071429
• WBRNAi00114330
• WBRNAi00114334

27 Allele

• gk964278
• gk964500
• gk962765
• gk963722
• gk963417
• ok372
• gk300
• gk480556
• gk811660
• gk339769
• gk467696
• gk327571
• gk451489
• gk735378
• gk677393
• gk537604
• gk909775
• gk849478
• gk935614
• gk510268
• gk914233
• gk207280
• gk207278
• gk207279
• WBVar01730153
• WBVar01854169
• WBVar01581678

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00020140
• Start: 8459178
• End: 8460308
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_8458934..8459177
• Length (nt): 244
• Chromosome Location: IV: 8458934-8459177
• Organism: Caenorhabditis elegans

209 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at L3 larva stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_L3
	Transcripts that showed significantly increased expression after 24 hours of induction of human beta Amyloid at young adult stage	A 2-fold change in expression level and a false discovery rate analog of p < 0.05.	WBPaper00064130:Beta-Amyloid_24h_upregulated_mRNA
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	mRNAs that showed increased expression in P-granule RNAi animales (simultaneously targeting pgl-1, pgl-3, glh-1 and glh-4) comparing to in control RNAi animals. Set 1 transcripts were defined as P-value < 0.05 and fold change > 2.	DESeq was used. Fold change between the average of the four control replicates and the average of the four test replicates was used to calculate the significance using a negative binomial distribution. An adjusted P-value was calculated using the Benjamini-Hochberg method for multiple testing correction.	WBPaper00046805:P-granule-RNAi_upregulated_Set1
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in Day 5 (5-days post-L4) vs. Day 0 (L4 larva) of adulthood N2 animals.	Differential expression for both small RNA- and mRNA-seq data was tested using DESeq2; P-values were adjusted for multiple testing by Benjamini-Hochberg method.	WBPaper00053318:Aging_downregulated_mRNA_N2
	Transcripts that showed significantly decreased expression in mir-71(n4115) comparing to in N2 at 4-days post L4 adult hermaphrodite.	Differential expression for both small RNA- and mRNA-seq data was tested using DESeq2; P-values were adjusted for multiple testing by Benjamini-Hochberg method.	WBPaper00053318:mir-71(n4115)_downregulated_mRNA
	Transcripts that showed significantly decreased expression in dissected female germline comparing to in dissected male germline.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:female_vs_male_downregulated
	Genes that showed increased expression after nicotic acid (NA) treatment.	Raw counts for the genes were analyzed using the R Statistical Computing Environment and the Bioconductor packages DESeq and edgeR. Both packages provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate (FDR). If both FDR values (by DESeq and edgeR) were smaller than p = 0.05, genes were assigned as differentially expressed.	WBPaper00044260:nicotinc-acid_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite npr-8(ok1439) animals grown at 25C, comparing to in N2 animals.	CuffDiff, fold change > 2.	WBPaper00065096:npr-8(ok1439)_upregulated_Day10_25C
	Transcripts that showed significantly increased expression in pie-1(ne4443[PIE-1-Degron-GFP])	DESeq2. Differentially expressed genes were defined as twofold change and adjusted p-value less than 0.05.	WBPaper00061478:pie-1(ne4433)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Transcripts that showed significantly increased expression in prg-1(tm872) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:prg-1(tm872)_upregulated
	Transcripts that showed significantly increased expression in ubc-9(ne4833[ubc-9(G56R)] in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:ubc-9(ne4833)_upregulated
	Transcripts that showed significantly decreased expression in rbr-2(tm3141) comparing to in N2 animals.	Mapped reads were analyzed for transcript assembly and differential expression using Cufflinks 2.1.1 with a filter of twofold difference and FDR correction (P < 0.05).	WBPaper00050080:rbr-2(tm3141)_downregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in mut-16(pk710), comparing to in N2 animals.	DESeq2 v. 1.22.2, adjusted p-value <= 0.05.	WBPaper00059605:mut-16(pk710)_upregulated

11 Expression Patterns

• Primary Identifier: Expr2009346
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6558
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC14673
• Reporter Gene: [T01B11.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGCGGCTACAGTGTTCT] 3' and primer B 5' [CTTACCTCCAGACATGCTTGC] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids

• Primary Identifier: Expr6559
• Remark: Also expressed in (comments from author) : unidentified part of the developing reprodctive system in larvae Strain: BC13886
• Reporter Gene: [T01B11.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGCGGCTACAGTGTTCT] 3' and primer B 5' [CTTACCTCCAGACATGCTTGC] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; unidentified cells in body

• Primary Identifier: Expr8111
• Remark: Picture: Fig. 6. ant-1.4 = T01B11.4
• Pattern: The ANT-1.4::GFP is expressed in a pair of neurons that sends a ciliary process to the tip of the head. Occasionally, green fluorescent protein (GFP) is also detected in the amphid socket and sheath cells. Expression is detected in one neuron located in the nerve cord identified as the VA11 motoneuron and occasionally in the rectal gland cell and at a lower level in an other motoneuron. The GFP signal is observed in the ventral nerve cord in neural processes that go to the nerve ring. The signal is also seen in a few body-wall muscle cells and the vulval muscle cells.

• Primary Identifier: Expr8114
• Remark: Picture: Figure 7.
• Subcellular Localization: The ant::GFP proteins were absent from the nucleus, distributed diffusely throughout the cytoplasm of all embryonic blastomeres and colocalized with a mitochondria marker

• Primary Identifier: Expr1038759
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1155704
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2027582
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1599
• Remark: Original chronogram file: chronogram.480.xml
• Reporter Gene: [T01B11.4:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1832
• Remark: Original chronogram file: chronogram.742.xml
• Reporter Gene: [T01B11.4:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1981
• Remark: Original chronogram file: chronogram.897.xml
• Reporter Gene: [T01B11.4:gfp] transcriptional fusion.

11 GO Annotation

3 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00020140
• Start: 8459178
• End: 8460308
• Strand: -1

11 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1131

1 Sequence Ontology Term