WormMine: Gene WBGene00022240

• WormBase Gene ID: WBGene00022240
• Gene Name: shl-1
• Sequence Name: Y73B6BL.19
• Brief Description: shl-1 encodes a SHAL/Kv4 ortholog, which encodes voltage-gated potassium channels expressed in muscle; mutations in shl-1 result in loss of all fast transient outward current from muscle cells and, in males, reduced mating efficiency owing to difficulty in locating the hermaphrodite vulva; when expressed in Xenopus oocytes or cultured myocytes, SHL-1 exhibits currents; an SHL-1::GFP reporter fusion is expressed in posterior intestine, body wall muscle, vulval muscle, male-specific diagonal muscles, and a number of motor neurons, interneurons, and sensory neurons.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable A-type (transient outward) potassium channel activity. Predicted to be involved in action potential and potassium ion transmembrane transport. Predicted to be located in membrane. Predicted to be part of voltage-gated potassium channel complex. Expressed in body wall musculature; muscle cell; neurons; pharynx; and tail. Human ortholog(s) of this gene implicated in Brugada syndrome 9 and spinocerebellar ataxia type 19/22. Is an ortholog of human KCND2 (potassium voltage-gated channel subfamily D member 2) and KCND3 (potassium voltage-gated channel subfamily D member 3).
• Biotype: SO:0001217
• Genetic Position: IV :3.19243 ±0.000428
• Length (nt): 5786

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00022240

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y73B6BL.19.1	Y73B6BL.19.1	2299	IV: 6378285-6384070

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y73B6BL.19	Y73B6BL.19	1737	IV: 6378759-6378836

5 RNAi Result

• WBRNAi00058317
• WBRNAi00086318
• WBRNAi00086317
• WBRNAi00086080
• WBRNAi00086321

73 Allele

• gk964500
• gk963722
• gk963417
• gk963416
• r930
• gk963709
• gk5522
• WBVar02020754
• WBVar00189900
• gk946228
• tm12745
• gk559687
• gk925938
• gk706515
• gk746935
• gk750652
• gk608650
• gk570484
• gk687147
• gk888653
• gk659926
• gk884942
• gk931643
• gk547532
• gk875264
• gk403942
• gk838232
• gk564108
• gk936753
• gk353263

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00022240
• Start: 6378285
• End: 6384070
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_6378169..6378284
• Length (nt): 116
• Chromosome Location: IV: 6378169-6378284
• Organism: Caenorhabditis elegans

105 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101.	DESeq2, Fold Change > 2 or < 0.5.	WBPaper00059566:wdr-23(mac32)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in pgl-1(ct131) animals (isolated from SS0002[pgl-1(ct131)him-3(e1147)], comparing to in control animals SS1174, at 1-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_pgl-1(ct131)_vs_control_day1-adult
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA

12 Expression Patterns

• Primary Identifier: Expr1161726
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2034042
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2098
• Remark: Other strain-- UL1136
• Pattern: Mosaic expression is seen in and around the pharynx of larvae and adults. Some of the expressing cells may be neuronal.

• Primary Identifier: Expr1017833
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr7114
• Remark: Also expressed in (comments from author) : incomplete. To be updated. Strain: BC10566
• Reporter Gene: [Y73B6BL.19::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTTTTGGCTTGAGACCACTATTC] 3' and primer B 5' [GCGATTCTGAAGAAGACAACG] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Expr7115
• Remark: Strain: BC12514
• Reporter Gene: [Y73B6BL.19::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTTTTGGCTTGAGACCACTATTC] 3' and primer B 5' [GCGATTCTGAAGAAGACAACG] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr2015809
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1039806
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram23
• Remark: Original chronogram file: chronogram.1018.xml
• Reporter Gene: [Y73B6BL.19:gfp] transcriptional fusion.

• Primary Identifier: Expr2801
• Pattern: Expressed in muscle.

• Primary Identifier: Chronogram1032
• Remark: Original chronogram file: chronogram.209.xml
• Reporter Gene: [Y73B6BL.19:gfp] transcriptional fusion.

• Primary Identifier: Expr8268
• Remark: Picture: Fig. 1, A and C; Table 1.
• Pattern: Expression of SHL-1 was observed in posterior intestine, body wall muscle, vulval muscle, male-specific diagonal muscles, and a variety of motor neurons, interneurons, and sensory neurons.

20 GO Annotation

12 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00022240
• Start: 6378285
• End: 6384070
• Strand: -1

20 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5786

1 Sequence Ontology Term