WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00015977 Gene Name  C18F10.2
Sequence Name  ? C18F10.2 Organism  Caenorhabditis elegans
Automated Description  Enriched in neurons and in male based on RNA-seq; single-cell RNA-seq; and microarray studies. Is affected by several genes including mter-4; etr-1; and rsr-2 based on tiling array; microarray; and RNA-seq studies. Is affected by five chemicals including tryptophan; Tunicamycin; and rifampin based on microarray and RNA-seq studies. Is predicted to encode a protein with the following domain: Phosphorylation site. Biotype  SO:0001217
Genetic Position  Length (nt)  ? 2859
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00015977

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C18F10.2.1 C18F10.2.1 2207   III: 6273168-6276026
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C18F10.2 C18F10.2 2136   III: 6273178-6273217

6 RNAi Result

WormBase ID
WBRNAi00000410
WBRNAi00040959
WBRNAi00040960
WBRNAi00011012
WBRNAi00005613
WBRNAi00005855

29 Allele

Public Name
gk964518
gk176284
gk176285
gk176286
gk176287
gk176288
WBVar01607077
WBVar01264294
WBVar01446118
WBVar01446116
WBVar01446115
WBVar01446114
gk954313
WBVar01837663
gk960850
ttTI35834
gk409803
gk465240
gk807478
WBVar01628596
gk592660
gk616648
gk740098
gk349010
gk442482
gk612386
gk743490
gk732984
WBVar01566629

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00015977 6273168 6276026 1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_6276027..6276047   21 III: 6276027-6276047 Caenorhabditis elegans

66 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes up regulated by Tryptophan. Differentially expressed genes had a fold change cutoff of 2.0 and an unpaired t test p value cutoff of 0.05 for WT+Trp versus WT and 0.01 for nhr-114 versus glp-1. WBPaper00042194:Tryptophan_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_aging
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts that showed significantly increased expression in cco-1(RNAi) comparing to in vector control animals. The limma package47 was used for differential expression. Genes with a Benjamini-Hochberg adjusted P-value <0.05 and an absolute log fold change of 2 were considered differentially expressed. WBPaper00053402:cco-1(RNAi)_upregulated
Reduced humidity (98% relative humidity). Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis. Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001. WBPaper00044578:reduced-humidity_downregulated_microarray
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:germline-precursors_blastula-embryo_expressed
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. DESeq2, FDR <0.05, fold change > 2. WBPaper00059664:srbc-48(ac23)_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin_downregulated
  Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction. WBPaper00060014:set-2(tm1630)_downregulated
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
24 hours of AgNPs exposure. Genes downregulated more than 2 fold after 24 hours of AgNPs exposure. Statistical differences between the control and exposed worms were determined by a parametric t test, and a Pearson correlation test was performed for correlation analysis, using the Statistical Package for the Social Sciences (SPSS, Chicago, IL). WBPaper00034661:AgNPs_downregulated
  Genes with significant increase of expression in UPF1 smg-2(RNAi) comparing to control. Bioconductor package LIMMA was used to determine differentially expressed genes. The P-values were adjusted for multiple testing with a false-discovery rate (50). Probe sets with fold-change > 1.5 and q-value < 0.05 were used as a cut-off for C. elegans microarrays WBPaper00042561:smg-2(RNAi)_upregulated
  Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage. DESeq2, fold change > 2 WBPaper00058725:sftb-1(cer6)_upregulated
Temprature shift to 28C for 24 hours. Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 24 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_24h_upregulated
Temprature shift to 28C for 48 hours. Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 48 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_48h_upregulated
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h). Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the -1h timepoint. Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_EtBr-exposed_48h
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h). Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-EtBr-exposed_48h
UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at just prior to the third UVC dose (48h). Genes differentially expressed under EtBr treatment and UVC exposure vs under UVC exposure but without EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:UVC-EtBr-exposed_vs_UVC-exposed_48h
UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed under EtBr treatment and UVC exposure vs under UVC exposure but without EtBr treatment at the -3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:UVC-EtBr-exposed_vs_UVC-exposed_51h

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC12482 [C18F10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAATATGTTTTGTTATGCCGCC] 3' and primer B 5' [ACGCATTCAGAGCAAAAGAAA] 3'. Expr5307 Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons;  
Original chronogram file: chronogram.1436.xml [C18F10.2:gfp] transcriptional fusion. Chronogram426    
    Expr2019206 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1145002 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1026518 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2000987 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00015977 6273168 6276026 1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
2859

1 Sequence Ontology Term