WormMine: AnatomyTerm WBbt:0005212

• Definition: the ganglion that lies above and behind the rectum in the tail, in close continuity with the anal hypodermal ridge. It contains 3 neuron cell bodies (DVA, DVB and DVC) that send their neuronal processes into the ventral nerve cord via dorso-rectal commissures that encircle the anus. The ganglion contains no local neuropil in the hermaphrodite. In the adult male tail, this ganglion gains additional neurons and some local neuropil.
• Name: dorso-rectal ganglion
• Primary Identifier: WBbt:0005212

1 Children

Definition	Name	Synonym	Primary Identifier
neuron whose cell body is in the dorsal-rectal ganglion.	dorsal-rectal ganglion neuron	dorso-rectal ganglion neuron	WBbt:0005801

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Single-cell RNA-Seq cell group 134_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:134_0

15 Expression Patterns

• Primary Identifier: Expr4900
• Remark: Picture: Figure 4.
• Pattern: UNC-69::GFP expression was first detectable in embryos. In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites. In older larvae and adults, UNC-69::GFP was expressed in neurons of the anterior, lateral, ventral and retro-vesicular ganglia in the head, and in neurons of the preanal, dorso-rectal and lumbar ganglia in the tail. The fusion protein was also present in the ventral nerve cord (VNC), in the dorsal nerve cord (DNC), in the dorsal and ventral sublateral nerve cords, and in commissural axons. The reporter was expressed in the neurons named CAN, HSN, ALM, PLM, AVM, PVM, BDU, and SDQR, as evidenced by its localization to the cell bodies of these neurons. Expression of unc-69 in these latter cells was confirmed using an unc-69::LacZ::NLS fusion.
• Subcellular Localization: In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites. In older larvae and adults, UNC-69::GFP was expressed in the cell bodies of neurons.

• Primary Identifier: Expr15024
• Pattern: Consistent with the previous report on the hermaphrodites' expression, we confirmed here that for both sexes, all three of pck-1-expressing reporters express in head and body wall muscles. However, we found that the reporters also express in ventral cord and preanal neurons and nerve ring neurons per side in the head. In the tail region, both larval males and larval/adult hermaphrodites express the transgenes in the dorsal rectal ganglion and three neurons per side in the tail. The adult male shows additional expression in sex-specific neurons of the ray, postcloacal, and spicule sensilla. None of the constructs promote expression in male or hermaphrodite sex muscles, intestine, or pharyngeal muscles.

• Primary Identifier: Expr652
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: beta-gal detected from late embryogenesis to adulthood. L1 expression restricted to gut cells (intestinal cells). L2-adult staining in gut, muscle, hypodermis, other epithelial cells, vulval cell and the nervous system (ganglia in the head and tail region and ventral nerve cord)

• Primary Identifier: Expr11508
• Pattern: the sta-1 promoter::NLS::GFP reporter gene was widely expressed in a variety of cells and tissues, during most life stages. Specifically, it was expressed at higher levels in pharynx compared to expression levels in other tissues. GFP was also apparent in the entire intestine, marking all nuclei. Fluorescence intensities of GFP appeared weaker in the anterior intestine than in the posterior intestine, but this effect was due largely to the anterior part of the intestine being obscured by the gonad, where no reporter gene expression was observed. GFP expression was also observed in body muscles as well as in most of the nervous system. Among neuronal cells, GFP expression was readily observed in head ganglia, particularly in the posterior ganglia, including the small dorsal ganglion, two lateral ganglia, and ventral ganglion. Similarly, the sta-1 promoter was functional in the two lumbar ganglia, the dorsorectal ganglion of the tail, and the ventral nerve cord. Developmentally, reporter gene expression was first observed in enclosure stage embryos in a variety of cells, and expression persisted throughout embryogenesis, the four larval stages, and the entire adult life span. Neither cell- nor tissue-specific expression pattern changes were observed during development, nor was there any evident modulation of expression level, as judged by fluorescence intensity. Furthermore, GFP expression persisted throughout the dauer larval stage, although GFP expression level decreased significantly, particularly in the pharynx. Similar conclusions concerning expression pattern were suported by analysis of protein distribution by immunofluorescence.

• Primary Identifier: Expr122
• Remark: Other strain-- UL403 late embryo(author) = elongating embryo + fully-elongated embryo(curator).
• Pattern: Expression begins in precomma stage embryos. It is quite strong, with extensive diffuse cytoplasmic staining as well as nuclear localised staining. Expression is strongest in young larvae, with staining observed in the ventral nerve cord, the circumpharyngeal nerve ring, the head ganglion, the tail ganglion, the retrovesicular ganglion, and in the developing vulva. In older larvae and in adults the strong pharyngeal expression seen in young larvae is less intense and some neuronal processes in the head become apparent (e.g. the motorneuron M1). There is also staining in the pharyngo-intestinal valve and in the seam cells, though expression appears to exclude the nuclei and is generally intermittent along the seam. The defecation muscle group stain as does its axon, DVB. The dorsal cord also stains but is very faint. Two commissures stain (these are also faint), one is located anterior to the vulva, and the other is posterior to the vulva.

• Primary Identifier: Expr7838
• Remark: Picture: Figure 4.
• Pattern: UNC-69::GFP expression was first detectable in embryos. In older larvae and adults, UNC-69::GFP was expressed in neurons of the anterior, lateral, ventral and retro-vesicular ganglia in the head, and in neurons of the preanal, dorso-rectal and lumbar ganglia in the tail. The fusion protein was also present in the ventral nerve cord (VNC), in the dorsal nerve cord (DNC), in the dorsal and ventral sublateral nerve cords, and in commissural axons. The reporter was expressed in the neurons named CAN, HSN, ALM, PLM, AVM, PVM, BDU, and SDQR, as evidenced by its localization to the cell bodies of these neurons. Expression of unc-69 in these latter cells was confirmed using an unc-69::LacZ::NLS fusion. Taken together, these results indicate that unc-69 is expressed widely, perhaps ubiquitously, in the C. elegans nervous system.
• Subcellular Localization: In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites.

• Primary Identifier: Expr50
• Remark: Fusion junction ...AGCTCTCCAACGATGTACGAGAGAAGGATGCTGGGAAGGTCGTGGAAGTGTTGAAAGTCACGACCACGG TCAATAGATTATGTAGAGGATTCCCTACGTCACGAGTATCTAGATGGATTGCAAGGGGAAGAGGACGCACTG GCAAAGATC/lacZ. Legacy Data: Author "Arnold JM" "Krupa AP" "Hope IA". Date 1992-01. Young and Hope (1993). Dev. Dynam. 196:124-132 = [cgc1752]
• Pattern: b-galactosidase expression in areas of all the major ganglia (lateral, ventral, retrovesicular, pre-anal and dorso-rectal), along the ventral nerve cord, occasionally in the spermathecal valves and in the vulva. Expression appears to be nuclear-localized, although cell bodies and neural processes in the ventral nerve cord also show staining. The pattern is first visualized as a stripe of staining following the curve of the elongating embryo, possibly corresponding to the embryonic ventral nerve cord which consists of the DA, DB and DD motorneurones

• Primary Identifier: Expr16049
• Pattern: nmgp-1 expresses mostly in sensory neurons and in the egg-laying apparatus of adult hermaphrodites. GFP expression driven by the putative nmgp-1 promoter was detected in several cells, primarily neurons. Within the head, we saw GFP expression in pharyngeal neurons, as many somas and processes within the metacorpus and the posterior bulb ventral ganglia were observed. In addition, some of the processes next to the bulb might correspond to CEP sheath glial cells. In the midbody, we saw labeling of cells within the egg-laying apparatus. Posteriorly, we observed cells in the tail ganglia and possibly phasmid neurons. Neuronal processes along dorsal and ventral cords were also labeled. In addition, to identify specific neurons, we used the NeuroPAL strain (OH15500) developed by Hobert's Lab (Yemini et al., 2021). This strain has a stereotyped fluorescent color map to identify all neurons. We injected it with the same plasmid for GFP expression under the nmgp-1 promoter. The following neurons were identified as expressing GFP: ALA, CEPD, IL1 (head neurons from the nerve ring), the sensory amphid neurons ASK, neurons from the anterior ventral nerve cord (VA6, VB7, DB5, AS5, VD6, DD3, DA4) and posterior ventral cord (VA11, VD11, AS10, DA7, DB7, CB11, VA11), neurons from the preanal ganglion (PVP, PVT, DD6, AS11, VA12, DA8, DA9) dorso-rectal ganglion (DVB, DVA, DVC) and lumbar ganglion (PVQ, PHC). The neurons identified include sensory neurons (amphid and mechanosensory), motor neurons and interneurons.

• Primary Identifier: Expr8704
• Remark: Picture: N.A.
• Pattern: In transgenic animals with the Ppcm-1::GFP fusion construct containing a nuclear localization signal, GFP expression was observed in non-identified head neurons, the ventral nerve cord and rectal ganglia in all developmental stages.

• Primary Identifier: Expr8324
• Remark: Picture: Figure S3.
• Pattern: GFP expression is observed in a subset of neurons in the pharyngeal nervous (PN) system, in numerous unidentified nerve ring (NR) interneurons, and in a subset of motor neurons of the ventral nerve cord (VNC). Expression is also observed in a few cell bodies of the dorsorectal and lumbar ganglia.

• Primary Identifier: Expr2246
• Pattern: In general, the expression patterns found for the translational fusion constructs were similar to those reported above for the transcriptional fusions. Cells were labeled in the anterior, lateral and ventral, and retrovesicular ganglion near the pharynx, in the ventral nerve cord, and in the pre-anal, dorso-rectal, and lumbar ganglion near the tail. Animals demonstrated labeling of the lumbar ganglion in an adult animal. HSN (hermaphrodite-specific neuron) was also labeled as were the vulC cells of the vulva and the excretory cell.
• Subcellular Localization: NHX-5 appeared to be associated with intracellular membranes. NHX-5::GFP expression occurred primarily in neuronal cell bodies. Labeling was granular in the cytoplasm and extended weakly through the neuronal cell processes.

• Primary Identifier: Expr13203
• Pattern: Three rectal glands; Faint expression in head and tail neurons: at least 6 neurons in the lumbar ganglion, at least 20 neurons in the anterior ganglion, at least 20 neurons in the lateral ganglia, 2 neurons in the dorsorectal ganglion.

• Primary Identifier: Expr649
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: beta-gal expression was seen throughout all developmental stages and in many tissues: intestine, muscle (probably body wall muscle), hypodermis, other epithelial cells, head and tail ganglia.

• Primary Identifier: Expr1122
• Pattern: Ventral and dorsal nerve cords, neurons in the head and tail ganglia, nerve ring, and the pharyngeal-intestinal valve.

• Primary Identifier: Expr592
• Remark: Reporter gene fusion type not specified. This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope). acy-1 = sgs-1 --WS59.
• Pattern: Expression is generally neuronal in the head ganglia (less extensive in anterior of the head ganglia), ventral nerve cord, tail ganglia, muscle cells of vulva and in adults expression is observed at low levels in the body wall muscle cells. Expression is faint or absent in the CAN cells and less extensive in anterior head ganglion.

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
ganglion in the tail region (posterior to rectum).	tail ganglion		WBbt:0006977