|
|
|
Expr4658
|
The antibody could detect MPS-4 expression in terminal bulb and in anterior, but not in posterior isthmus or corpus. When the head of the worm is cut, the corpus remains covered by the cuticle because the body wall muscles contract. Thus, the cuticle might have prevented the antibody to stain the corpus even after robust permeabilization. However, in intact worms permeabilized by the same freeze-crack method authors detected expression in terminal bulb and isthmus (albeit les intense) but not in corpus. Further, in the cut head preparations, metacorpus and the region of corpus immediately adjacent to it are usually not covered by the cuticle and yet the antibody failed to detect MPS-4 (n=3). This suggests that even if MPS-4 is expressed in corpus, the protein level is low. The antibody did not stain the pharynx of mps-4 KO nematodes confirming its specificity. Notably, the expression pattern of MPS-4 partially overlapped with that of EXP-2 indicating that the two proteins colocalize in specific areas of the pharynx. |
|
|
|
|
Expr4456
|
Expressed in the hypodermis from embryo stage through adulthood. Expressed in the rectal epithelial cells from L1 and maintain through adulthood. Expressed in the terminal bulb of the pharynx. Expressed in socket cells of IL or OLQ. |
|
|
|
|
Expr4446
|
F27E11.3A is expressed in three cells around the nerve ring, possibly neurons, in two cells in the posterior bulb of the pharynx, and in the pharyngeal marginal or muscle cells. |
|
|
|
|
Expr4449
|
Expressed in the terminal bulb of the pharynx,weak in larvae and strong in adults. |
|
|
|
|
Expr4442
|
T23D8.1 is expressed in a few cells in the nerve ring, putatively identified as neurons. In addition, there is also expression in the intestine, in one cell on the ventral side of the terminal pharyngeal bulb and two cells around the anus. |
|
|
|
|
Expr16196
|
Similar to T. spiralis stichosome, constituting excretory-secretory system opening to the esophagus, also C. elegans L3 and L4 larva pharyngeal glandular cells, extending ducts to both anterior and posterior bulbs of the pharynx, revealed the presence of high thymidylate synthase both protein and mRNA levels. |
|
|
|
|
Expr16366
|
We found that IDPA-3, IDPB-3, IDPC-1, FIPR-4, and NSPB-12 are expressed exclusively in association with the pharynx and overlap in their localization with the pharynx cuticle. Briefly, tagged IDPA-3 was enriched in the grinder, overlapping the CFW-stained component and lining of the terminal bulb cuticle. In addition, we observed enrichment of tagged IDPA-3 in the presumptive ECM that lies between the terminal bulb and the intestinal valve. Tagged IDPB-3 was expressed weakly and localized exclusively to the pm6 cells and material surrounding the CFW-stained grinder. Tagged IDPC-1 had a similar pattern to that of tagged ABU-14; associating with both the anterior and posterior components of the pharyngeal cuticle. However, tagged ABU-14 appears to localize adjacent to CFW-stained components whereas tagged IDPC-1 overlaps CFW-stained components. Tagged NSPB-12 localized to the anterior pharynx cuticle components exclusively, including that of the buccal cavity, flaps, and anterior channels. Tagged FIPR-4 localized to both anterior and posterior pharynx cuticle components (but not the grinder teeth proper) and the presumptive pharynx-intestinal valve ECM. |
|
|
Picture: Fig 7. |
|
Expr8960
|
SAX-7 is also expressed in muscle, as revealed by immunostaining of SAX-7 in wild-type animals. |
SAX-7 is localized to sarcomeres and membrane boundaries; both signals are absent in sax-7(eq1) animals. |
|
|
|
Expr11141
|
Both EAT-17 and RAB-6.2 are highly expressed in the pharyngeal muscle. RAB-6-2 is also highly expressed in neurons. EAT-17 expression was also detected in the intestine and vulva. |
|
|
Reporter gene fusion type not specified. |
|
Expr1744
|
F42G10.2 expressed in pharyngeal muscles and several unspecified neurons. The promoter of F42G10.2 was not active in the intestine, anus, or excretory cell. Promoter activity observed throughout the pharynx. GFP observed in the corpus, isthmus and terminal bulb. |
|
|
|
|
Expr11170
|
nasp-1::GFP was localized primarily in the pharynx. Expression was seen in the metacorpus and terminal bulb of the pharynx with clear intracellular localization. |
|
|
|
|
Expr1200129
|
Data from the TransgeneOme project |
|
|
|
|
Expr13901
|
Prib-1::gfp is broadly expressed in ectodermal and mesodermal cells during embryogenesis. A salient feature of the rib-1 expression pattern is that it is very dynamic in hypodermal cells during development. In embryogenesis, Prib-1::gfp is detected along the entire layer of hypodermoblasts that surrounds the gastrulating embryo at about 200 minutes after fertilization. By the early comma stage of embryogenesis, Prib-1::gfp is expressed at high levels in hypodermal cells of the elongating embryo, including hypodermal cells extending ventrally during ventral closure and in the two rows of dorsal hypodermal cells undergoing dorsal intercalation. Following these embryonic morphogenetic events, expression of Prib-1::gfp in the hypodermal cells of the body wall is no longer visible during larval and adult stages, except for seam cells undergoing fusion during larval development. Also, hypodermal cells of the developing vulva express Prib-1::gfp, at a low expression level in L3 larvae and at a stronger level in L4 larvae and just molted young adults, and vanishing in vulval cells in the adult. The nervous and digestive systems express Prib-1::gfp stably and continuously from embryogenesis throughout adulthood. Strong and sustained expression is seen in motorneurons, interneurons, sensory neurons (including AVM), neurons in the head and tail ganglia, with the GFP signal filling axons running along the ventral and dorsal nerve cords, commissures, and sublaterals. Expression in neurons of the ventral nerve cord and of the head ganglia is visible in 1.5-, 2-, and 3-fold embryos, and persists into adulthood. Strong expression of Prib-1::gfp is also observed in the pharynx from the 2-fold stage of embryogenesis onwards and remained strong in adults (procorpus, metacorpus, terminal bulb, grinder, and pharyngeal-intestinal valve). The anal depressor, the anal sphincter, the two enteric muscles, the spermathecae and the uterine muscles maintain expression in adults. |
|
|
The authors have changed the name of the protein described in the paper from CUP-1 to ChUP-1, given that CUP-1 was already taken by a family of genes with unknown function. |
[ChUP-1::GFP] translational fusion. ChUP-1 stop codon was removed by PCR using the following primers: TCTAGAATGAGGACCTCACAGGCG and GGATCCCCTCCGAAAACTCGAATTGTATTCC. The product was cloned in pEGFP-N1 from Clontech (Mountain View, CA. USA) and the chimeric vector was transfected in HEK293-FT cells using Lipofectamine/PLUS Reagent (Invitrogen) in 35 mm dishes according to manufacture instruction. [chup-1::GFP] translational fusion. chup-1 stop codon was removed by PCR using the following primers: TCTAGAATGAGGACCTCACAGGCG and GGATCCCCTCCGAAAACTCGAATTGTATTCC. The product was cloned in pEGFP-N1 from Clontech (Mountain View, CA. USA) and the chimeric vector was transfected in HEK293-FT cells using Lipofectamine/PLUS Reagent (Invitrogen) in 35 mm dishes according to manufacture instruction. |
Expr10014
|
ChUP-1 expression was detected in all developmental stages by RT-PCR and no differences were detected in mRNA levels. The ChUP-1::GFP signal was especially strong all along the worm intestine. The pharynx also showed GFP signal, especially at the terminal bulb and presumably, the excretory gland cells. Although fluorescence was not as strong as that observed in other structures, GFP was also observed in embryos. |
The subcellular localization of ChUP-1 was determined in human embryonic kidney cells (HEK293 FT). In general, the ChUP-1-GFP signal was detected in a punctuated pattern resembling the vesicle-like structures observed in C. elegans. Remarkably, GFP signal colocalized with the plasma membrane marker FM4- 64 (R = 0.47). Colocalization signal was also observed in endocytic vesicles, as a result of FM4-64 endocytosis. These structures might correspond to early endosomes. We observed a strong colocalization signal between ChUP-1-GFP and the endosome marker RhoB (R=0.91) and Lysosotracker (R=0.84) but not with mitochondrial or nuclear markers (data not shown). Additionally, inmmunostaining against the human Golgin-97 showed the presence of ChUP-1-GFP in the Golgi (R = 0.92). The subcellular localization of ChUP-1 was determined in human embryonic kidney cells (HEK293 FT). In general, the ChUP-1-GFP signal was detected in a punctuated pattern resembling the vesicle-like structures observed in C. elegans. Remarkably, GFP signal colocalized with the plasma membrane marker FM4-64 (R = 0.47). Colocalization signal was also observed in endocytic vesicles, as a result of FM4-64 endocytosis. These structures might correspond to early endosomes. We observed a strong colocalization signal between ChUP-1-GFP and the endosome marker RhoB (R=0.91) and Lysosotracker (R=0.84) but not with mitochondrial or nuclear markers (data not shown). Additionally, immunostaining against the human Golgin-97 showed the presence of ChUP-1-GFP in the Golgi (R = 0.92). |
|
|
|
Expr14682
|
We first show the localization of UNC-59 at the cleavage furrow (previously shown with antibody staining, (Nguyen et al. 2000)) during a time lapse of cell divisions in early 2- to 4-cell stages of embryogenesis and throughout embryogenesis (cleavage rings in older embryos. Septins are also important for gonad morphogenesis and distal tip cell (DTC) migration (Nguyen et al. 2000) where UNC-59 protein is detected throughout gonad development in the rachis (previously shown with endogenously tagged unc-59::mKate, (Priti et al. 2018)) and DTCs. We highlight UNC-59/Septin localization in the DTC (previously shown with a transgene, (Finger et al. 2003)) at the L2 and L3 stages where it is organized into bundles (DeMay et al. 2011) and ring structures. The two bilateral sex myoblast cells express UNC-59 during their posterior to anterior migration in the L2 and early L3 stage and continue to express UNC-59 in these cells as they differentiate into vulval muscles in the late L3 to early L4 stages. Lastly, we show UNC-59/Septin expression and localization in tissue not previously reported: in the pharynx (cells of the buccal cavity, anterior procorpus, and terminal bulb); in the seam cells, both in bundles and at the cleavage furrows, beginning in the L1 stage and continuing throughout development and into the adult; and in sperm surrounding an embryo that has exited the spermatheca. |
|
|
Picture: Figure 9. |
|
Expr7872
|
Transgenic animals carrying the csq-1::gfp fusion constructs showed expressions of GFP in body-wall muscles beginning from the 2-fold stage embryo through to adult stages. In addition, GFP signals were observed in vulval muscles and in the isthmus and terminal bulb regions of the pharynx. |
|
|
Clone: pUL#IAH1G4 |
|
Expr7498
|
4 of 8 lines showed expression in metacorpus and terminal bulb of the pharynx, late embryogenesis to adult. (Other 4 lines showed no expression.) Terminal bulb expression was stronger. UL2417 and UL2419 look integrated. Occasionally a single cell in the nerve ring showed expression. |
|
|
Clone: pUL#JRH/AE09 |
|
Expr7416
|
From late embryo to adult can see strong expression in the procorpus and metacorpus of the pharynx as well as four cells within the terminal bulb (which may be muscle cells). Post hatching (and possibly in late embryos) can see expression in tail in the muscles linked to the rectum. Vulval-related expression is also observed as cells either side of the forming vulva in larval stages and in only the very external cells of the opening in adult stages. |
|
|
Clone: pUL#JRH/AG10 |
|
Expr7522
|
Expression is seen in 3 cells in the terminal bulb of the pharynx and in the junction between the pharynx and intestine, late embryo onwards, weakening through the larval stages. There is also expression in the developing gonad, possibly the spermathecae. However, all the expression is quite weak. |
|
|
|
|
Expr14340
|
Labeled EXC-2 is located at the lumen of the excretory canal, in the corpus, posterior bulb, and pharyngeal-intestinal valve of the pharynx, as well as in the uterine seam and intestinal-rectal valve. |
Labeled EXC-2 is located apical to canal cytoplasm, as determined via cross-sectional fluorescence intensity measurements. This result was confirmed by evaluating the subcellular location of EXC-2 relative to a known apical membrane protein, ERM-1 (Gbel et al. 2004). The results demonstrate that EXC-2 and ERM-1 show overlapping expression at the canal apical (luminal) membrane. |
|
|
|
Expr3929
|
Transgenic nematodes that express GFP under the predicted cst-1 promoter (Pcst1::gfp) were generated. In five independent transgenic lines, Pcst1::gfp was widely expressed in epidermal cells and was accompanied by intense staining in cells in the tail, vulva, and sensory neurons in the head and weaker expression in the dorsal pharyngeal bulb. |
|
|
Other strain-- UL481. Legacy Data: "Bauer PK" "Mounsey A" "McCarroll D" "Hope IA"Date 1998-12. late embryo(author) = 3-fold embryo(curator). |
|
Expr112
|
This neuronal pattern gives expression throughout all life stages of C. elegans. Staining is first seen in precomma stage embryos. In 3-fold embryos expression appears to be localised in nuclei around the pharynx and tail. In young larvae there is extensive staining in all of the head ganglia and the anal ganglion. The ventral nerve cord and its cell bodies also show strong expression. As the worm ages the expression in the head ganglia is reduced to a number of nuclei in the ventral (ie AIML/R?) and lateral ganglion, although expression in the nerve ring and the ventral nerve cord is still observed. There appears to be some mosaicism in the expression as some larvae show stronger staining in the ventral nerve cord and more nuclei stain in the head ganglia, whereas in other larvae head expression is reduced and only the cell bodies of the ventral nerve cord stain. Diffuse expression is sometimes observed in the metacorpus and terminal bulb of the pharynx in larvae and adults. |
|
|
|
|
Expr1200022
|
Data from the TransgeneOme project |
|
|
|
|
Expr15267
|
IFC-2a/e::YFP is localized in the intestine, the excretory canal, corpus and posterior bulb of the pharynx, pharyngeal-intestinal valve and interfacial uterine cells. |
|
|
|
|
Expr15268
|
No intestinal expression can be observed for IFC-2a/b/c, which instead presents a very prominent localization in the intestinal-rectal valve. Expression is also observed in the excretory canal, corpus and posterior bulb of the pharynx, pharyngeal-intestinal valve and interfacial uterine cells. |
|
|
Reporter gene fusion type not specified. |
|
Expr1954
|
Corpus and terminal bulb of pharynx; few head neurons; tail hypodermis; posterior intestine; some vulva, uterine muscles. |
|
|
|
|
Expr3055
|
The CeENT1-GFP fusion protein was produced throughout the life cycle, from late embryo stage through the larval stages to the adult, but only in a limited number of cell types. The CeENT1-GFP fusion protein was particularly abundant in the pharyngeal musculature, notably in the terminal bulb and procorpus. The fusion protein was also strongly evident in all of the intestinal cells both of larvae and adults. |
Fluorescence was most marked at the cell surfaces, suggesting that the fusion protein was correctly inserted and targeted to the plasma membranes. |
|
|
|
Expr3056
|
The CeENT2 fusion protein showed a temporal and spatial pattern of expression very similar to that of ZK809.4::GFP (see Expr3055). The chief difference was that the CeENT2-GFP fusion protein was more abundant in the isthmus and metacorpus regions of the pharynx than the CeENT1-GFP fusion protein. |
Fluorescence was most marked at the cell surfaces, suggesting that the fusion protein was correctly inserted and targeted to the plasma membranes. |
|
|
|
Expr1200031
|
Data from the TransgeneOme project |
|
|
|
|
Expr9346
|
cwn-2 transcripts mainly localized to head neurons, anterior body wall muscle cells, anterior P.n cells and the intestine. The highest cwn-2 transcript count was observed around the terminal bulb of the pharynx, with a gradual decline in expression levels in more posterior cells. The mostly anterior expression of cwn-2 and posterior expression of cwn-1 was already observed at the 100-cell stage of embryonic development. |
|
