|
|
Expr4719
|
Pharyngeal muscles (pm7), intestine, (posterior>anterior), head neurons. |
|
Embryos at the ~200 cell stage contain 24 clonally committed pharyngeal precursors located in the anterior of the embryo (13 ABa-derived and 11 MS-derived), and the location of the 12 tbx-2::gfp expressing cells at this stage suggests that they are included among these precursors. To determine if these early tbx-2::gfp expressing cells were indeed pharyngeal precursors and to characterize their lineal origin, athors examined expression of a tbx-2::gfp promoter fusion containing the same tbx-2 5'-flanking sequences characterized above fused to gfp just downstream of the tbx-2 translation initiation codon (pOK206.30). Previous studies demonstrated that such promoter fusions can produce a longer lived GFP signal than full-length protein fusions. This tbx-2::gfp promoter fusion produced cytoplasmic GFP first detected in premorphogenetic embryos in the same pattern as full-length fusion protein, but GFP perdured in the pharynx until near hatching. GFP expression was observed in 3-fold embryos and early larvae in a reproducible subset of pharyngeal muscles, with occasional expression in body wall muscles and head neurons. GFP was observed predominantly in pharyngeal muscle types derived solely from ABa or from mixed lineages, and the number of these GFP-positive cells was generally consistent with those containing ABa-derived cells. However, exceptions to this generalization were found. Most notably, GFP was reproducibly observed in one MS-derived m7 muscle and all three m4 muscles (of which 2 contain only MS-derived cells). Taken together, these results strongly suggest that tbx-2::gfp expression in premorphogenetic embryos is limited to pharyngeal precursors, and most of these are ABa-derived, although expression is also likely in a small number of MS-derived pharyngeal precursors. |
|
Expr4285
|
In transgenic embryos, this larger tbx-2::gfp reporter was expressed in a dynamic pattern, including in a subset of pharyngeal precursors in the premorphogenetic embryo, as well as body wall muscle and pharyngeal neurons. tbx-2::gfp expression initiated in 2 anterior cells in approximately 100 cell embryos and increased to 12 cells by approximately the 200 cell stage. The increasing number of GFP expressing cells was not due to cell divisions; rather tbx-2::gfp expression appeared to initiate asynchronously in individual cells. Expression in these cells was transient and was undetectable by the bean stage. Prior to the bean stage, tbx-2::gfp expression was also observed in body wall muscles, and later, in 2- to 3-fold embryos, expression was observed in a number of pharyngeal neurons. Expression in both of these tissues continued in larvae. |
This full-length fusion protein is nuclear localized. |
ace-3 and ace-4 are transcribed together from an operon. |
|
Expr4203
|
The construct was expressed in many cells outside the pharynx, including body wall muscle and neurons, and in several muscle cells within the pharynx, including pm3, pm4, pm5 and pm7. |
|
Isoform 1b.2 |
|
Expr11756
|
|
|
|
|
Expr11436
|
Cbr-puf-2 is expressed in the pharyngeal muscle 7. The GFP signal could only be detected during a brief window from the late fourfold embryo to the early second larval stage. Cbr-puf-2 reporter expression is also seen in four vulval muscle (vm) cells starting in L4. It is expressed in the anchor cell and vulval muscles, but not in the vulva precursor cells (VPCs) themselves. |
|
This Expr_pattern is about CeTMIV, an isoform of tmy-1 transcription. To confirm the CeTMIV isoform expression pattern, corresponding tmy-1::gfp vectors were assayed. Similar GFP expressions induced in pharynx and intestines respectively. These results show that the CeTMIV isoform was expressed in the pharyngeal muscles and intestinal cells and establish that the primary promoter region was located within 853 bp upstream of the initial ATG. pretzel stage (author) = fully-elongated embryo (wjc). |
|
Expr1679
|
The constructs pTMZIV4349 and pTMZIV1957 induced beta-galactosidase expressions in both the pharyngeal muscles and intestinal cells with similar intensities. Specifically, pharyngeal expressions were observed in all the eight muscle cells (m1-m8), one marginal cell (mc), one epithelial cell (e1) and the four cells of the pharyngo-intestinal valve (PIV). The 20 intestinal cells, some of which are binucleated and localized alongside the intestine, posterior of pharynx and anterior of anus were all stained with intense staining occurring at the most posterior end. Intestinal staining was limited only to intestinal cells, although there were slight variations in position of nuclei and staining intensity. Expression was also detected in embryos between gastrulation and the comma stage. At this stage of development, the exact nuclei are difficult to identify, but the positions and topology suggest pharynx and intestines. By the pretzel stage, identification of the different pharyngeal muscles showing expression becomes possible. A similar expression was also observed in the pharynx of males, although the intestinal staining was more restricted to the posterior region. No expression was induced by the further deletion construct pTMZIV1219. In all cases, the most uniform and intense expression patterns were observed between L1 and L2 worms, and were completed by L2. From L3 to adult, there was a reduction in expression intensity. Both pharyngeal and intestinal expressions were evident within six hours after staining. |
|
Feature : "myo-2.B207" |
|
Expr11410
|
Multimers of a single oligonucleotide from the B fragment (B207) activate pharyngeal expression in a pattern very similar to that observed with the duplicated B fragment, with expression predominately in pharyngeal muscles m3, m4, m5 and m7. Unlike the larger B fragment, the B207 oligonucleotide occasionally activates additional expression in cells other than pharyngeal muscle (e.g. pharyngeal marginal cells, body wall musculature and intestine). |
|
Feature: 'WBsf919537::pPD95.21' |
|
Expr11811
|
The distal enhancer activated reporter gene expression both inside and outside the pharynx. In larvae and adults, expression was observed in the m3, m4, m5, and m7 pharyngeal muscles as well as pharyngeal marginal cells, epithelial cells, and neurons. Expression was also observed outside the pharynx in the body wall muscles and the ventral nerve cord. Distal enhancer activity initiated in the pharynx at the bean stage of embryogenesis near the time that the endogenous ceh-22 gene is first expressed. |
|
|
|
Expr2705
|
The large majority of GFP signal, at all stages of development, is in the intestine. The first GFP signal can be detected at the 1.5-fold stage of embryogenesis; by the 3-fold stage, GFP expression is easily detected in all cells of the gut. Late in embryogenesis, GFP expression can be detected in nine nuclei in the posterior bulb of the pharynx, bracketing the pharyngeal grinder. Both gut and pharynx expression continue throughout the remaining stages of development. On the basis of nuclear position, the nine expressing cells are the two triads of m6 and m7 muscle cells, as well as the immediately posterior triad of marginal cells. |
nuclei |
|
|
Expr9722
|
Expression becomes detectable around the comma stage of embryogenesis and persists through adulthood. Expression in vulval precursor cells is strong and can first be seen in L3. PQN-47::GFP is expressed in seam cells, peaking at L2 and ceasing after the seam cells differentiate in late L4, concurrent with the appearance of alae. The intestine shows variably undetectable to low pqn-47 expression (always less than in the neurons) and gets dimmer as development progresses, especially after L3. The two bulbs of the pharynx, specifically pharyngeal muscle cells pm3-8 (not pm6), are variably bright. Overall expression levels are lower in adults than younger animals, with only some expression in head and tail neurons remaining. Head and nerve ring neurons, pharyngeal cells, ventral nerve cord cells, vulval precursor cells, seam (though interestingly not hyp7), as well as cells in the tail show the strongest pqn-47 expression. Muscle, intestine, the distal tip cells of the gonad, the spermatheca, and a large neuron that may be CAN that is essential for survival but of unknown function near the vulva (also bathed in pseudocoelom fluid, and next to the seam and canal cells), as well as a subset of the ciliated neurons of the head (amphid neurons ASI, ADL, ASK, or AWB) and tail including phasmid cilia PHA and PHB, also express pqn-47. We could not detect expression in the pharyngeal glands as reported for a different promoter pqn-47 fusion construct made as part of a high-throughput analysis of gene expression, although other tissues did show similar patterns. Promoter and translational reporters show pqn-47 expression in numerous somatic cells, including cells uniquely poised to mediate or transmit signal(s) involved in the regulation of molting, some of which have been implicated in molting. For example, many cells expressing PQN-47 have significant exposure to the pseudocoelom, and as such are candidates to transmit or detect endocrine signals; the H-shaped excretory cell and its ducts, which form extensive gap junctions with the hypodermis and lie against the pseudocoelom along the entire body of the worm (Nelson and Riddle, 1984), the head mesodermal cell (hmc) lies in the pseudocoelom up against the (excretory) gland cell and forms gap junctions with them and muscle, and the VPI cells at the juncture of the pharynx and intestine are bathed by the pseudocoelom, as well as the intestine itself. |
|
Legacy Data: Author "Lynch AS" "Bauer PK" "Hope IA"Date 1996-06. |
|
Expr68
|
The M2 interneurons and m7 muscles in the terminal bulb of the pharynx express ZC21.4 in adulthood only. A neuronal cell abutting the mass of the nerve ring also stains, but expression here is weaker (marked * in the image). |
|
Feature : "ceh-22.pe39_pe41" |
|
Expr11279
|
Both pe39 and pe41 enhanced expression specifically in pharyngeal muscles. Transgenic lines bearing pe39:: pes-10::lacZ and pe41::pes-10::lacZ reporters exhibited robust reporter gene expression in the m3, m4, m5, and m7 pharyngeal muscles, cells that express the endogenous ceh-22 gene. In addition,the pe41::pes-10::lacZ was also expressed in one non muscle cell in the pharynx (provisionally identified as a g1 gland), the pharyngeal-intestinal valve cells, and a pair of neurons outside the pharynx. The onset of pharyngeal-galactosidase expression was as early as the comma stage of embryogenesis, and expression persisted in the pharyngeal muscles through the remainder of embryogenesis and larval development. Both the spatial and temporal specificity of the pe39 enhancer in particular was nearly indistinguishable from that of the full-length proximal enhancer. |
|
|
|
Expr11290
|
Eeak expression, pharynx: pm6-8, mc1-3, some glands, pharyngo-intestinal valve, gut, rectal glands, body wall muscle (adult only), in young larvae: unidentified head cell (head mesodermal cell?), CAN. |
|
Picture: Figure 6. |
|
Expr7891
|
The CDR-4-eGFP fusion protein was expressed predominately in the intestinal cells of the nematodes. |
It was concentrated in small punctate structures within these cells. The size and distribution of these structures were similar to those of lysosomes and of CDR-1-eGFP. It has been shown that when a nonfusion form of eGFP is expressed in intestinal cells, it accumulates in the cytoplasm, not in vesicles. The transgenic nematodes were fed rhodamine B isothiocyanate (RITC)-labeled dextran, which labels intestinal cell lysosomes, to confirm that CDR-4 was targeted to the lysosomes. In the double-labeling experiment, both eGFP and rhodamine colocalized to the same structures, confirming that CDR-4 is targeted to intestinal cell lysosomes. |
Other strain-- UL747, UL756, UL757 |
|
Expr140
|
A less frequently observed components is of nuclei in the tail which is most likely hypodermis. A less frequently seen component is in vulC and vulD of L4 larvae and adult worms. Expression seen in unidentified groups of cells in elongating embryos. The most common and obvious component of this expression pattern is the strong staining in the terminal bulb of the pharynx (m6 and m7). Also fainter expression in the m2 nuclei of the procorpus. The most common and obvious component of this expression pattern is the strong staining in the terminal bulb of the pharynx (m6 and m7). Other less frequently observed components are-- vulC and vulD in L4 and adult worms, nuclei in the head and tail which are most likely hypodermis, m2 nuclei in the procorpus, and unidentified patches of staining in elongating embryos. |
|
Identical staining pattern observed with both antisera (ST::CEH-22 and poly-his::CEH-22 ). Reporter_gene X-gal staining identical to anti-CEH-22 antibodies (Construct contains ~4 kb of ceh-22' -flanking DNA fused to lacZ within the ceh-22 5'-UTR.) This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope). see Expr748 for western analysis data. |
|
Expr603
|
Antibody staining limited to nuclei within pharynx and is detected from beginning of morphogenesis onwards. CEH-22 first detected approx. 330 minutes after fertilization (the lima bean stage) in 11-14 pharyngeal muscle nuclei (probably pharyngeal muscle). At 1.5-fold stage, 14-23 pharyngeal nuclei stain. Cells identified as m3, m4, m5 and m7. In embryos that have completed elongation (pretzel stage), CEH-22 positive nuclei are identified as m3, m4, m5 and m7. Also detected in 6 other pharyngeal nuclei, which are believed to be m1 muscles. After hatching, staining persists in m1, m3, m4, m5 and m7 but absent in m6 and m2. |
|
Reporter gene fusion type not specified. This Expr_pattern is about CeTMIII, an isoform of tmy-1 transcription. |
|
Expr1680
|
The constructs pTMZIII4135 and pTMZIII1743 permanently induced beta-galactosidase expression in pharyngeal muscles and intestinal cells of the worm from L4 stage. Pharyngeal expression was observed in m1, m3, m4, m5 and m7 muscle cells. Between the L2 and L3 stages, both constructs induced expression in tissues corresponding to germ-line tissue of the gonadal primordium: one anterior and one posterior. At this stage, intestinal expression was restricted to the most posterior part of the worm. The expression in the germ-line tissue was eliminated by L4 stage. The beta-galactosidase expression of CeTMIII isoform was stage specific. In about 95 % of L1 worms, expression was observed in the pharynx only; between L2 and L3 stages, the expression extended further to germ-line tissue and intestinal cells. Permanent expressions in pharynx and intestines were evident from L4 stage and continued to adulthood. The pharyngeal staining was much stronger than those of germ-line tissue and intestines. Unlike CeTMIV isoform, embryonic expression of CeTMIII isoform was absent and the expression intensity of intestinal cells did not decrease with stage. |
|
Picture: Fig 3. |
|
Expr8678
|
Expression in the alimentary canal: Strong and consistent expression in pharyngeal epithelium, pm1, pm2, pm3, pm6, pm7, pm8, mc1, mc2, mc3. Weak or rare expression in pm4, pm5. Expression in the nervous system: DDn, DVA, DVB, DVC, PVP. Expression in the reproductive system: In adult stage, expressed in proximal gonad sheath, spermatheca. In developing larva stage, expressed in uterus, spermatheca. inx-10 is localized to pharyngeal precursors from early stages of embryogenesis, and by three-fold stage, all pharyngeal muscles except pm4 are seen to express it at high levels. |
|
|
|
Expr11324
|
Fairly weak expression, pharynx: pm3,4,6,7,8 mc1,3, glands (strong), excretory cell, hypodermis (borderline detectable). |
|
|
|
Expr2624
|
Promoter-GFP transgenes indicated that lam-3 is expressed during gastrulation and through embryogenesis in pharyngeal, intestinal and epidermal cells. In the larvae, lam-3 gene expression is maintained in the spermatheca and in the pharyngeal m3-m8 and mc cells. |
|
Picture: Fig 3. |
|
Expr8677
|
Expression in the alimentary canal: Strong and consistent expression in anterior arcades, posterior arcades. Weak or rare expression in pm2, pm3, pm4, pm5, pm6, pm7, pm8, mc1, g1, g2, rectal gland cells, rectal epithelial cells. Expression in the nervous system: Phsh, AVK, DVC (early larva), PVR, SIB (early larva), URB, I3. Expression in the reproductive system: In adult stage, expressed in gonad sheath, uterus, vulval muscle. In developing larva stage, expressed in vulva. Neuronal expression of inx-9 appears around three-fold stage. The rectal gland expresses inx-9 during early larval stages. inx-9 is expressed in adult hermaphrodite sex muscles. inx-9 was expressed at high levels in arcade cells starting around two-fold stage continuing throughout development and adulthood. |
|
Picture: N.A. |
|
Expr8691
|
Expression in the alimentary canal: Strong and consistent expression in pm2, pm4, pm5, mc1, mc2. Weak or rare expression in pm3, pm6, pm7, pm8, K.a/K$(B!G(B cells. |
|
|
|
Expr13079
|
The short ilys-3 promoter drove GFP expression mainly in the pharynx grinder muscles pm7, the isthmus marginal cell mc2 and muscle cell pm5. In addition, all intestinal cells exhibited ilys-3 promoter activity, with some variability. Intestinal expression of ilys-3 appeared to be temporally regulated. GFP was first detected in intestine of L1 hatchlings but declined at the L2 transition. By the L4 stage, the intestinal GFP signal became stronger and continued through adulthood. The intensity of GFP was very high in aging adult worms that were no longer self-fertile. Whereas the intestinal expression of ilys-3 changed during larval growth and adult life, the pharyngeal GFP reporter expression remained constant in larval and adult stages. Weak epidermal promoter activity was also detected. The long ilys-3 promoter revealed additional GFP expression in the six scavenger coelomocyte cells, but at a significantly lower level in other tissues. |
|
Legacy Data: "Bauer PK" "Mounsey A" "Royall CM" "Hope IA" Date 1997-06. |
|
Expr92
|
This pattern is very strong. This strain requires less than one hour of incubation for the pattern to be clearly seen. If left longer, non-localised staining of the pharyngeal muscles occurs obscuring the nuclei. There are three components to this pattern. The first is diffuse staining nucei in the procorpus (m2 and m3). The second is strong expession in the m4 nuclei in the metacorpus, and the final component involves m5, m6 and m7 in the terminal bulb. There is some mosaicism exhibited as not all components are seen in all worms. No staining has been seen in the isthmus. |
|
Legacy Data: Author "Lynch AS" "Bauer PK" "Hope IA"Date 1996-06. |
|
Expr62
|
Expression is evident in both the metacorpus and terminal bulb of the adult pharynx. B-gal staining seems to be sub-cellularly localised in the pseudocircular m4 muscle cells in the metacorpus; staining in the terminal bulb is restricted to the posterior of the bulb, and so may mark the location of the m7 muscles. |
|
|
|
Expr13989
|
In the posterior pharyngeal bulb gfp::hum-7 is expressed throughout, including the pm6 and pm7 cells that help the grinder contract during feeding (Worm Atlas), while hmr-1::mKate2 is enriched only in apical regions, as expected. hmr-1::mKate2 is expressed all through the nerve ring axons, while gfp::hum-7 is expressed in adjacent cells, perhaps glia. Viewing this same strain on the surface shows that while hmr- 1::mKate2 is highly expressed in the seam cells, gfp::hum-7 shows no obvious overlap in the seam cells. A strain expressing RFP under control of the myosin heavy chain promoter, Pmyo-3::rfp (Viveiros et al., 2011), shares expression with gfp::hum-7 in body wall muscles. Therefore gfp::hum-7 appears to have broad expression, with enrichment in several types of muscle tissue including regions of the pharynx, and in body wall muscles. Expression is not overall enhanced in neurons, but may include support cells for neurons. Expression does not appear enhanced in epidermal cells, although there is precedent for epidermal signal to appear striped due to impingement from muscle or pharynx (Worm Atlas). Antibody staining with antibodies specific to body wall muscle support that at least some of the striped signals are in muscle. |
|
|
The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones. |
Expr9566
|
Expression is evident in both the metacorpus and terminal bulb of the adult pharynx. B-gal staining seems to be sub-cellularly localised in the pseudocircular m4 muscle cells in the metacorpus; staining in the terminal bulb is restricted to the posterior of the bulb, and so may mark the location of the m7 muscles. |
Sub-cellular localization within the body wall muscle: Cytoplasm +/- Other |
Picture: Fig 3. |
|
Expr8671
|
Expression in the alimentary canal: Strong and consistent expression in pharyngeal epithelium, pm5, pm6, pm7, pm8, g2, rectal gland cells. Weak or rare expression in anterior arcades, posterior arcades, pm2, pm3, pm4, M3, MC, intestine, rectal epithelial cells. Expression in the nervous system: CEPsh, ALN, ASn, CAN, DAn, DBn, DDn, DVA, DVB, HSN, PDE, PLM, PVQ, PVR, PVT, URB, VAn, VBn, VDn, M3, MC. Expression in the reproductive system: In adult stage, expressed in spermatheca, vulval muscle, HSN. In developing larva stage, expressed in vulval muscle, uterine muscle, HSN. inx-3 was expressed broadly during early embryogenesis. After the beginning of morphogenesis, inx-3 expression becomes more restricted to the pharynx, hypodermis, and intestine. By three-fold stage inx-3 expression appears in ventral cord motor neurons (strongest in DA neurons) along with continued strong pharyngeal expression. By hatching, its hypodermal expression disappears, while postembryonically born ventral cord motor neurons express it at low levels. Its pharyngeal (strong) and neuronal (faint) expressions continue to adulthood. |
|
Other strain-- UL308. |
|
Expr101
|
Staining is first observed in precomma stage embryos. In all larval stages, expression is seen sporadically, as a number of nuclei in the head and occasional rows of paired nuclei down the body. This pattern seems to be highly mosaic as the number nuclei in the head bodywall that stain varies considerably. This mosaicism is also evident in expression of the bodywall nuclei in the body. These appear to be bodywall muscle. Some of the staining in the head appears to be that of the nuclei of the pharyngeal muscles (m2, m3, m4, m5, m6, m7). This component is a common feature of expression patterns from fusions with incomplete promoters, but this does not seem to be the case in this situation. Occasional staining in the nuclei of the posterior intestine is also seen. |
|
Picture: N.A. |
|
Expr8675
|
Expression in the alimentary canal: Strong and consistent expression in pm5, MC. Weak or rare expression in pharyngeal epithelium, pm1, pm2, pm3, pm4 pm6, pm7, pm8, g1, g2, rectal gland cells. Expression in the nervous system: ADE, AIY, ALM, ALN, AVA, AVK, AVM, BDU, CAN, DAn, DVA, DVB, DVC, FLP, HSN, LUA, PLM, PLN, PVC, PVM, PVP, PVQ, PVT, PVW, RID, RIS, SDQ, URB, MC. Expression in the reproductive system: In adult stage, expressed in HSN. Faint hypodermal expression of inx-7 is seen around two-fold stage and becomes stronger by threefold stage. |
|