WormMine: ExpressionPattern Expr5489

• Pattern: Larval Expression: excretory cell; Nervous System; nerve ring; tail neurons
• Primary Identifier: Expr5489
• Remark: Strain: BC13616
• Reporter Gene: [dyf-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCTTGCTTGACTAGATTCCC] 3' and primer B 5' [GCCACAATTGATTGATACTTGAA] 3'.

4 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
H-shaped cell associated with the excretory system, largest cell in C. elegans.	excretory cell	excretory canal cell	WBbt:0005812
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00001123	dyf-7	C43C3.3	Caenorhabditis elegans

1 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023