WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: excretory cell; Nervous System; nerve ring; tail neurons; Primary Identifier  Expr5489
Remark  Strain: BC13616 Reporter Gene  [dyf-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCTTGCTTGACTAGATTCCC] 3' and primer B 5' [GCCACAATTGATTGATACTTGAA] 3'.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001123 dyf-7 C43C3.3 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023