WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: rectal epithelium; amphid socket cells; unidentified cells in tail ; Larval Expression: rectal epithelium; hypodermis; seam cells; amphid socket cells; unidentified cells in tail ; Primary Identifier  Expr5345
Remark  Strain: BC13003 Reporter Gene  [C26F1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTGTTAACGGGTTTTTAAGTGA] 3' and primer B 5' [TTTTAGGTGAAGTGGGTCGTG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

6 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
Amphid socket cell, left AMsoL lineage name: ABplpaapapa WBbt:0003931
Amphid socket cell, right AMsoR lineage name: ABprpaapapa WBbt:0003929
posterior region, from rectum to the end tail   WBbt:0005741
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001719 grl-10 C26F1.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023