WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: anal depressor muscle; Reproductive System; spermatheca; excretory cell; Larval Expression: hypodermis; excretory cell; Primary Identifier  Expr5088
Remark  Also expressed in (comments from author) : mosaic population Strain: BC12593 Reporter Gene  [C01B12.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTTCTTCCGGAATTTCTATTTTT] 3' and primer B 5' [AAAAATATTGATTGAAAAATGCC] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

5 Anatomy Terms

Definition Name Synonym Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
Epidermal layer. hypodermis epidermis WBbt:0005733
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00015286 best-3 C01B12.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023