WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; head mesodermal cell; Larval Expression: intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; head mesodermal cell; Primary Identifier  Expr5664
Remark  Strain: BC15747 Reporter Gene  [F02E8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAACACTGTAGGGGTTTGAA] 3' and primer B 5' [TAGAGCGCGTTTGGATTTTT] 3'.

6 Anatomy Terms

Definition Name Synonym Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
  rectal gland cell   WBbt:0005799
Head mesodermal cell, function unknown head mesodermal cell hmc WBbt:0004697
left intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_L lineage name: ABplpppppaa WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_R lineage name: MSppaapp WBbt:0003822

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00017178 atg-16.1 F02E8.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023