WormMine: ExpressionPattern Expr5664

• Pattern: Adult Expression: intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; head mesodermal cell; Larval Expression: intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; head mesodermal cell
• Primary Identifier: Expr5664
• Remark: Strain: BC15747
• Reporter Gene: [F02E8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAACACTGTAGGGGTTTGAA] 3' and primer B 5' [TAGAGCGCGTTTGGATTTTT] 3'.

6 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents.	anal depressor muscle	dilator muscle	WBbt:0004292
	rectal gland cell		WBbt:0005799
Head mesodermal cell, function unknown	head mesodermal cell	hmc	WBbt:0004697
left intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_L	lineage name: ABplpppppaa	WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_R	lineage name: MSppaapp	WBbt:0003822

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00017178	atg-16.1	F02E8.5	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023