WormMine: AnatomyTerm WBbt:0004697

• Definition: Head mesodermal cell, function unknown
• Name: head mesodermal cell
• Primary Identifier: WBbt:0004697
• Synonym: hmc

1 Children

Definition	Name	Synonym	Primary Identifier
nucleus of pedigree MSappaaa	MSappaaa nucleus		WBbt:0002083

7 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly lower expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:hmc_biased
	Top 300 transcripts enriched in head mesodermal cell according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:hmc
	Single-cell RNA-Seq cell group 110_1 expressed in mesoderm.	scVI 0.6.0	WBPaper00065841:110_1
	Transcripts enriched in hmc according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:hmc_enriched
	Top 300 transcripts enriched in head mesodermal cell, MSpppaaa according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:hmc_and_homolog
	Top 300 transcripts enriched in head mesodermal cell according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:hmc_homolog
	Single-cell RNA-Seq cell group 103 expressed in: hmc.	CellRanger, DecontX, Monocle3, Louvain algorithm.	WBPaper00065623:103

101 Expression Patterns

• Primary Identifier: Expr4734
• Pattern: A transcriptional arg-1::gfp reporter is expressed in the head mesodermal cell, the vulval muscles, and the enteric muscles.

• Primary Identifier: Expr5232
• Remark: Strain: BC14110
• Reporter Gene: [C10E2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAACACATTTTTCTCACATTG] 3' and primer B 5' [CTGGTGCACCTGTGATTTTCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; developing gonad; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5192
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15491
• Reporter Gene: [C06G3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAATTTTTGTAGAAAGTGTGGG] 3' and primer B 5' [TTTGTCGATTTTGAACTTGGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr5176
• Remark: Also expressed in (comments from author) : GLR head neurons are expressing (Hall Lab, 2005). Strain: BC14109
• Reporter Gene: [snx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAAAACTGAAGGTTGGTTGT] 3' and primer B 5' [CTTCCGACAAGATTTCCAGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; Reproductive System; spermatheca uterine valve; head mesodermal cell; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; head mesodermal cell; coelomocytes; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5136
• Remark: Strain: BC14237
• Reporter Gene: [C03H5.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCATTTTCCATTTTCGTC] 3' and primer B 5' [TCGTTAGCTCGATTGATGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5494
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11019
• Reporter Gene: [ost-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCAATAAACAAAACACATCTGG] 3' and primer B 5' [GACGGCGAATGAAGAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head

• Primary Identifier: Expr5475
• Remark: Strain: BC11195
• Reporter Gene: [C39F7.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGGCGGCAAAATCTAAA] 3' and primer B 5' [GAGCTCTTCCTCGATTTTTGAA] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; spermatheca; head mesodermal cell; Nervous System; head neurons; Larval Expression: Reproductive System; developing vulva; head mesodermal cell; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5460
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14164
• Reporter Gene: [C37C3.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; head mesodermal cell; Nervous System; neurons along body; Larval Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; body wall muscle; head mesodermal cell; Nervous System; neurons along body

• Primary Identifier: Expr5527
• Remark: Strain: BC14848
• Reporter Gene: [prx-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTGGTTTCCCCGTTTTT] 3' and primer B 5' [TTTTGGAGAAGCTGAACGAGA] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; head mesodermal cell; hypodermis; unidentified cells in body ; Larval Expression: intestine; rectal gland cells; head mesodermal cell; hypodermis

• Primary Identifier: Expr5365
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14966
• Reporter Gene: [glc-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTTCTTATTAGTTCGTGCGGAT] 3' and primer B 5' [AGCTGAGCTTTGATTACGAAGAAT] 3'.
• Pattern: Adult Expression: intestine; anal depressor muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: intestine; anal depressor muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr5352
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15592
• Reporter Gene: [C27C12.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTAGAGACACCGTGATCCCC] 3' and primer B 5' [ACAATTTGTGATTCCGCCTCT] 3'.
• Pattern: Adult Expression: head mesodermal cell; Larval Expression: head mesodermal cell

• Primary Identifier: Expr5353
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14919
• Reporter Gene: [dpf-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACCTGGTCTCGACACATTTT] 3' and primer B 5' [ATCATTCTCCATTTTTCGAAACTC] 3'.
• Pattern: Adult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; head mesodermal cell; seam cells; unidentified cells in head; Larval Expression: anal depressor muscle; head mesodermal cell; seam cells; unidentified cells in head

• Primary Identifier: Expr5318
• Remark: Strain: BC14065
• Reporter Gene: [C23H4.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTGCAAAAATAGACGTTGAACC] 3' and primer B 5' [GATCACGCCTAAAATTGATGGT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; neurons along body; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; neurons along body; unidentified cells in tail

• Primary Identifier: Expr5308
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15500
• Reporter Gene: [C18F10.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGTCAACCATCGTCTTCC] 3' and primer B 5' [GGGATTCCGCCTGAAAAT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; head mesodermal cell; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; head mesodermal cell; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5041
• Remark: Strain: BC13872
• Reporter Gene: [ckb-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTGAAAAGTTTAACTACAAAACTG] 3' and primer B 5' [TTTGGAGAAACAAAATTGTATGG] 3'.
• Pattern: Adult Expression: intestine; head mesodermal cell; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; hypodermis; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5096
• Remark: Strain: BC14898
• Reporter Gene: [C01G10.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAATGCTTGAAAGGTAGTAACG] 3' and primer B 5' [GGAAGGATTTTTCTGAAATTGAAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; head mesodermal cell; Larval Expression: pharynx; intestine; rectal gland cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in head

• Primary Identifier: Expr7117
• Remark: Strain: BC14342
• Reporter Gene: [Y73B6BL.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTAATGCTAATTTTGCTCCCT] 3' and primer B 5' [ACTTGTGGTAGCGATATCTAAAAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulva other; body wall muscle; head mesodermal cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; body wall muscle; head mesodermal cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5691
• Remark: Also expressed in (comments from author) : ubiquitous expression Strain: BC14337
• Reporter Gene: [erd-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAATGGCAATTGAACTCCG] 3' and primer B 5' [TCTGCGTTATGGAAGAACAGAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5667
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15543
• Reporter Gene: [F07A11.2a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAATTTTTCTGATTTCTGTGGG] 3' and primer B 5' [AATTCCGCAGATTTTGGATG] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; vulval muscle; body wall muscle; head mesodermal cell; seam cells; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; body wall muscle; head mesodermal cell; seam cells; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5663
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16151
• Reporter Gene: [F02E8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAACACTGTAGGGGTTTGAA] 3' and primer B 5' [TAGAGCGCGTTTGGATTTTT] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; head mesodermal cell; Larval Expression: stomato-intestinal muscle; head mesodermal cell

• Primary Identifier: Expr5664
• Remark: Strain: BC15747
• Reporter Gene: [F02E8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAACACTGTAGGGGTTTGAA] 3' and primer B 5' [TAGAGCGCGTTTGGATTTTT] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; head mesodermal cell; Larval Expression: intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; head mesodermal cell

• Primary Identifier: Expr5656
• Remark: Strain: BC13861
• Reporter Gene: [let-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACAGATATGAACGGTGGAATTT] 3' and primer B 5' [TCGTTGCTTCATGGTGGTAG] 3'.
• Pattern: Adult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; head mesodermal cell; Nervous System; head neurons; unidentified cells in head; Larval Expression: anal depressor muscle; distal tip cell; head mesodermal cell; Nervous System; head neurons; unidentified cells in head

• Primary Identifier: Expr5539
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15594
• Reporter Gene: [C49G7.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTTTCGGCGAGATTGCTT] 3' and primer B 5' [GGGCAGCGATTTCAATTTT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal epithelium; Reproductive System; spermatheca; head mesodermal cell; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; developing vulva; developing spermatheca; head mesodermal cell; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5633
• Remark: Also expressed in (comments from author) : the pharyngeal bulbs express but not the isthmus Strain: BC11352
• Reporter Gene: [ptb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCGAAAATTGCCTCAGAA] 3' and primer B 5' [ATGCTCACCTTGGTGATGTG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterus; vulval muscle; spermatheca; head mesodermal cell; unidentified cells in head; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing uterus; developing spermatheca; head mesodermal cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5632
• Remark: Strain: BC10287
• Reporter Gene: [ptb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCGAAAATTGCCTCAGAA] 3' and primer B 5' [ATGCTCACCTTGGTGATGTG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; anal sphincter; Reproductive System; uterine muscle; vulval muscle; spermatheca; head mesodermal cell; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; anal sphincter; head mesodermal cell; Nervous System; head neurons

• Primary Identifier: Expr5611
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14205
• Reporter Gene: [D1046.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAATGCCTATCAAATGCGAA] 3' and primer B 5' [CGATCAATCCTCAAACAAACAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; head mesodermal cell; hypodermis; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; hypodermis

• Primary Identifier: Expr5778
• Remark: Strain: BC13122
• Reporter Gene: [F16H11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAAAGGCGTGGTACAACAGTAAAA] 3' and primer B 5' [TGAAAAATCAAACAATGAAAGGAA] 3'.
• Pattern: Adult Expression: head mesodermal cell; Larval Expression: head mesodermal cell

• Primary Identifier: Expr5865
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC13313
• Reporter Gene: [gon-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCAGAATGAACAAAGGGGGT] 3' and primer B 5' [CGGATACCAACAGCTCCG] 3'.
• Pattern: Adult Expression: anal sphincter; Reproductive System; vulval muscle; spermatheca; body wall muscle; head mesodermal cell; Nervous System; head neurons; tail neurons; Larval Expression: anal sphincter; body wall muscle; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5814
• Remark: Also expressed in (comments from author) : hypodermis is in the head. Strain: BC14036
• Reporter Gene: [F20H11.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGCTTAGTGTCCTTTTACCTCC] 3' and primer B 5' [AGCATACCACCTGCGATTAAATA] 3'.
• Pattern: Adult Expression: Reproductive System; vulva other; gonad sheath cells; head mesodermal cell; hypodermis; unidentified cells in head; Larval Expression: head mesodermal cell; hypodermis; unidentified cells in head

• Primary Identifier: Expr6551
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16323
• Reporter Gene: [R53.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAATTTCAACCGTTTCCTAGCTT] 3' and primer B 5' [AATGCGATTTTCTGAAAGAAGAAG] 3'.
• Pattern: Adult Expression: pharynx; head mesodermal cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; Larval Expression: pharynx; intestine; rectal gland cells; head mesodermal cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons

12 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching.		embryo Ce	WBls:0000003
	The C. elegans life stage spanning 620-800min(hatch) after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. A stage after elongation is over. The last stage of embryogenesis. Also called pre-hatched embryo, late embryo or morphogenetic embryo.		fully-elongated embryo Ce	WBls:0000021
	The C. elegans life stage spanning 350-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The stage that embryo starts elongation until elongation is over.		elongating embryo Ce	WBls:0000015
	The C. elegans life stage spanning 290-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage when embryo just finished gastrulation and is enclosing.		enclosing embryo Ce	WBls:0000013
	The C. elegans life stage spanning 100-290min after first cleavage at 20 Centigrade. Proliferate from 28 cells to 421 cells. Referring to the whole period of gastrulation.		gastrulating embryo Ce	WBls:0000010
	The C. elegans life stage spanning 0-350min after first cleavage at 20 Centigrade. Proliferate from 1 cell to 560 cells. From start of first cleavage until cleavage is over.		proliferating embryo Ce	WBls:0000004
	The C. elegans life stage spanning 390-420min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo looks like a comma. A stage between bean embryo and 1.5-fold embryo.		comma embryo Ce	WBls:0000017
	The C. elegans life stage spanning 460-520min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and double fold. A stage between 1.5-fold embryo and 3-fold embryo.		2-fold embryo Ce	WBls:0000019
	The C. elegans life stage spanning 520-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and tripple fold. A stage between 2-fold embryo and fully-elongated embryo. Also called pretzel embryo or pretzel stage.		3-fold embryo Ce	WBls:0000020
	The C. elegans life stage spanning 420-460min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and fold back 50%. A stage between comma embryo and 2-fold embryo.		1.5-fold embryo Ce	WBls:0000018
	The C. elegans life stage spanning 350-390min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. Emrbyo elongation started but have not formed comma shape yet. The shape of embryo looks like a lima bean. A stage right before comma embryo. Also called lima embryo or lima bean stage.		bean embryo Ce	WBls:0000016
	The C. elegans life stage spanning 210-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage before the fast cleavage of cells finishes.		late cleavage stage embryo Ce	WBls:0000014

3 Parents

Definition	Name	Synonym	Primary Identifier
a cellular object that consists of subcellular components, expresses genes or functions.	Cell	Cell type	WBbt:0004017
the organ system that allows the animal move, includes all muscles.	muscular system		WBbt:0005737
embryonic cell	MSappaa		WBbt:0006509