WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; unidentified cells in head; Larval Expression: pharynx; body wall muscle; unidentified cells in head; Primary Identifier  Expr5591
Remark  Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10178 Reporter Gene  [dnj-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTCTGAAATTTTGGTTTGGA] 3' and primer B 5' [AATTGCAACGGCAAGGAATA] 3'.

5 Anatomy Terms

Definition Name Synonym Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001025 dnj-7 C55B6.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023