WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulval muscle; spermatheca; body wall muscle; Primary Identifier  Expr5852
Remark  Strain: BC11029 Reporter Gene  [F25B5.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCGAGTGCGTTCTGGAAA] 3' and primer B 5' [TCCTTGCACCACTGATCTTTTA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00017778 nono-1 F25B5.7 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041